The Cobra Event, Page 21
Richard Preston
The only part of the boxes not yet studied was the wooden material of the box itself. James Lesdiu pondered it. He didn’t recognize the type of wood. He didn’t recognize the design and style of the box, either. It was clearly handmade, and Lesdiu guessed that either Archimedes had made the box himself or that he had bought it at a trinket shop. Reachdeep needed a forensic botanist. Lesdiu called Washington and asked that an expert on wood be flown to Governors Island. Then he photographed the boxes in different kinds of light. He was especially interested in the small pieces of paper that were glued to the boxes. He set up a camera stand and photographed the papers with different kinds of light shining on them. It seemed that the Unsub had been careful to avoid watermarks when cutting the paper. The text itself was from a high-resolution laser printer. The type font was Courier, a common font. While F.B.I. scientists could identify characters from an old-fashioned typewriter, they could not identify laser-printer output. The chemical composition of the paper might lead to a particular manufacturer, but that would probably not be helpful in finding the Unsub.
Every detail of the boxes had been chosen by the Unsub to be hard to trace.
WILL HOPKINS HAD SET UP a series of videoconference meetings with molecular biologists at the Centers for Disease Control and at USAMRIID at Fort Detrick. The experts told him that the Cobra chimera had been built on the most common laboratory strain of baculovirus. It was available through the mail, and it was in use everywhere in the world. The experts told him that they did not know how the virus could be made to replicate explosively in human cells. One of them said to him, “It’s doable. But I just don’t know how. The baculovirus is adaptable, and someone’s figured out how to adapt it to humans, that’s all.”
Mark Littleberry studied James Lesdiu’s magnified photographs of the bits of paper glued to the boxes. He was interested in the drawing of a bioreactor that appeared on Harmonica Man’s box. He had never seen this exact type of bioreactor before, but in studying the drawing he became convinced that it had been done from life. The drawing had been made by Archimedes using a simple drawing program on a computer, and then it had been shrunk to a tiny size on a laser printer. The drawing was sketchy, but Littleberry believed it had been done by someone who had used a bioreactor and knew exactly how it worked. But who had manufactured the bioreactor? Littleberry and various F.B.I. agents with Masaccio’s task force studied sales catalogs and made telephone calls asking about the designs of bioreactors made by companies in the United States. It was not an American design. Littleberry came to suspect—it was a gut feeling, but he couldn’t prove it—that the bioreactor came from either an Asian biotechnology company or from perhaps Russia. Tracing it would be very difficult.
The forensic Reachdeep operation was not going as well as Hopkins had hoped. The idea that so many lives might depend on his team’s work frightened him. At times he wished he had never joined the F.B.I. Even though he was dog-tired, he found that he couldn’t sleep, and he wondered if he was getting an ulcer.
During a discussion of the Unsub’s motives, Hopkins suddenly hurried out of the meeting room, and people heard him throwing up in the bathroom. He came out after a while looking shaky. He said that he had been drinking too much coffee. Some of them were afraid he might be getting sick with the virus, but they didn’t know what to say or do about it.
“I’m scared for Will,” Littleberry later remarked to Austen. “I’m wondering if he made promises he can’t keep.”
Chimera
HOPKINS WAS THINKING ABOUT the virus that he and Littleberry had found in Iraq. The drawing of the bioreactor on the cobra box looked somewhat like the bioreactor that he had seen inside the truck in Iraq—at least from what he could remember. The possibility that the deaths in New York were a terrorist event being sponsored by Iraq weighed on him. He discussed it by phone with Frank Masaccio. Masaccio was very disturbed by this. “If this is terrorism sponsored by a foreign government, Will, this could start a war.”
“I know, Frank,” Hopkins said.
Hopkins put in a call to the Navy’s Biological Defense Research Program in Bethesda, where one of his contacts, a Navy doctor named John Letersky, was working through the night. Letersky was a member of the group that supplied Felix equipment to the F.B.I. He had been trying to analyze the chunks of genetic material that Hopkins and Littleberry had beamed up to the satellite when they’d been locked in the rest room.
“Will! How are you doing?” Letersky said.
“The truth is, I’m scared, John. We have a bitch of an investigation that’s going nowhere.”
“I’m hearing about it.”
“What can you tell me about the stuff we got in Iraq?”
“It’s bad, Will,” Letersky said.
“How bad?”
“Those crystals you swabbed in the truck? Looks like they were Ebola virus crystals. But some of the DNA sequences show similarities to influenza virus. Problem is, you didn’t get enough DNA. We don’t know what the Iraqis were dicking around with in the truck, except that the virus had Ebola in it, and might also have flu in it.”
Hopkins let out a deep breath. There was no apparent connection between the virus in New York and what he had found in Iraq. This made him feel better, for reasons he could not quite articulate.
“So what’s the White House going to do about Ebola in Iraq?” he said.
“Nothing. You heard that off the record, okay? Trying to get the White House to pay attention to bioweapons is like pulling teeth. We’ll submit a report to the United Nations, and that’s as far as it will go. The Iraqis will claim we made a mistake or we’re lying, and the White House will drop it. You guys were way outside the limits. We don’t have a real sample. And the truck’s long gone.”
HOPKINS WENT back to work with the Felix machines, and late in the afternoon he had a breakthrough. The following genetic sequence came up on the screen of one of the Felixes:
gaccatattcaggagaaccaaagcccaagactaaaatcccagaaaggcgtgtagtaacacag
It looked no different to Hopkins than any other string of genetic code. The human mind can’t read the text of life as easily as it can read Shakespeare. But the GenBank computer could read it. Hopkins got this answer back:
Sequences producing High-scoring Segment Pairs:
Human rhinovirus 2 (HRV2) complete n… 310 5.8e-18 1
Human DNA sequence from BAC 32281 on… 110 0.53 1
Mus musculus vibrator critical regio… 107 0.87 1
“Human rhinovirus,” Hopkins muttered. “Human rhinovirus. The common cold!” He jumped to his feet. “My God! Cobra’s got a piece of the common cold in it!”
He ran to the window of the Core and pounded on the glass. “Hey everyone! We’ve got the common cold!”
Hopkins continued picking the genes apart using Felix. He couldn’t believe it. It took his breath away. This was impossible. Cobra was partly a common cold. He couldn’t figure how it had been mixed with a butterfly virus. It made no sense to him. Somehow the creators of Cobra had managed to make a sticky molecule of some kind on the virus particle that enabled it to grab on to the mucus membranes of the body, especially in the area of the mouth and nose.
“The victims look like they have a cold, when they first get sick,” Austen remarked to him. “Kate Moran, especially, had a streaming cold.”
“No doubt she felt as if she had a cold,” Hopkins said. “This bastard of a virus probably attaches itself to the eyelids—cold viruses do that—or to the membranes in the nose. That would explain the design of the cobra box—it blows virus in your face. I just wonder if it’s engineered to get into the lungs, too.”
“But how does it move to the brain?” Austen asked.
“It likes nerves,” he said. “The optic nerves and the olfactory nerves in the nose are hard-wired straight into the brain, aren’t they, Alice?”
She nodded.
“So Cobra hits a mucus membrane and it zooms for the brain,” he said. “Cobra is a biological missile desig
ned to take out the brain. There’s no cure for the common cold. The common cold is very contagious. Cobra is the ultimate head cold.”
One of the two Felix machines beeped. His fingers danced over the keys, and he stared at the screen. “Yup. Here’s another cold gene. It’s surrounded by expression cassettes of unknown biologic function. Hm, hello? What’s this? Hm.” His fingers clacked away, and genetic code unreeled across the screen, the language of life twisted into a secret poem of death.
Dawn
MONDAY, APRIL 27
ALICE AUSTEN was assigned a simple Coast Guard officer’s room as a bedroom. It overlooked the quiet waters of the bay, where the running lights of container ships flickered in the moving air. The only furniture in the room was a metal folding cot with blankets and sheets. Someone, probably an F.B.I. agent from Masaccio’s office, had gone over to Kips Bay, gathered up her personal things, brought them here, and left them sitting on the bed. That vaguely embarrassed her. She turned on her cell phone and debated calling her father, but decided not to. She would wake him up again if she called now. Then she lay back on the bed and looked up at the ceiling. She was too tired to take off her clothes. She began to doze off. Suddenly it was five-thirty in the morning, and the birds were singing in the gray light.
Suzanne Tanaka stayed up most of the night, working alone in the Core. Most of the team had gone off to get some sleep. But she could not sleep. She was too keyed up. She looked at more electron-microscope images for a while, then decided to look at the mice again. It would be too soon to see any symptoms, but you never knew.
She bent over the boxes. They were clear plastic, and the mice were white mice, and they were moving around, because mice are active at night. They seemed fine. Except for one male mouse. He seemed wobbly. She looked at him more closely. He was very active. He was chewing on a wooden nibble block. Chewing and chewing. But mice normally chew a lot; chewing is rodent behavior. She looked at the clock on the table. She had injected the mice with Glenn Dudley’s brain material just last night, and now it was the early hours of the morning. That was too little time for a mouse, even with its fast metabolism, to be showing clinical signs of infection by Cobra. And there was no evidence to show that Cobra could infect rodents anyway. Nevertheless, the mouse’s chewing behavior bothered her: then again, this was probably her imagination talking to her.
She did not want to make any mistakes. She had begged Will Hopkins to put her in the group. She decided, finally, that she would bleed all the mice—take blood samples from all of them. Maybe the blood would show signs of infection, maybe not.
She went over to a cargo box that held her animal kits, and she got a soft leather glove and some disposable syringes. She pulled the leather glove over her surgical glove. She opened a box and removed the first mouse, holding it in her gloved hand in a practiced way. The mouse struggled.
She placed the needle under the mouse’s skin and withdrew a few drops of blood. The mouse was struggling wildly. He’s as afraid as I am, in his dim little way, she thought. Just then the mouse flipped out of her gloved hand and landed across her right hand, the one without the leather glove. For just an instant the mouse bit through the latex rubber and hung on with its teeth and let go.
Tanaka gasped and juggled the mouse back into its box.
It was just a nip. For a moment she didn’t think the animal had drawn blood. She inspected her rubber glove. Then she saw it: two red dots on her right index finger, where the mouse’s front teeth had penetrated. The slightest smear of blood welled up under the rubber.
“Damn!” she said.
It could not be. Was there any virus circulating in the mouse’s bloodstream? We don’t even know if Cobra can infect a mouse. Yet she had heard stories of people pricking their fingers in the Army hot labs. If it was a hot agent, incurable, you had between ten and twenty seconds to remove the finger with a clean scalpel. Otherwise the agent would move down your finger and enter your main blood system, and it could go anywhere. You had a twenty-second window of opportunity to save your life by cutting off your finger.
She dashed over to a cargo box, found a scalpel, stripped it, fitted the blade—quick!—and slammed her hand down on the box. She held the scalpel clumsily with her left hand, poised to slash it down on her finger.
And didn’t do it. Couldn’t.
This is crazy, she told herself. I don’t want to lose my finger.
And then the twenty seconds had passed, and the choice was no longer hers to make. She put the scalpel down. Sweat poured from her face. Her Racal hood fogged up, and Tanaka realized that she was weeping.
Stop this, stop this. I’ll be all right, she told herself, I’ll be all right. This was not an exposure, she told herself. We don’t even know if it can live in mice. I’ll just have to wait and see, but I know I’ll be all right. I will not tell anyone. Because they’ll take me off the investigation, and this is my first big case.
Morning
ALICE AUSTEN RETURNED to the Reachdeep unit shortly after the sun came up, and she found Suzanne Tanaka sitting in the meeting room drinking coffee. Tanaka looked exhausted.
“You need to get some sleep, Suzanne,” Austen said to her.
“I wish I could.”
Hopkins was talking on the telephone to John Letersky of the Navy’s Biological Defense Research Program in Bethesda. It was six o’clock in the morning, and Letersky was still there. “What I need, John, are some antibody probes for insect nuclear virus. Do you have any probes like that?”
“No way,” Letersky said.
“It would be good if we could program the hand-helds to detect Cobra,” Hopkins said. “We’d like to be able to test blood and tissue, and we want to do quick environmental sampling for the presence of Cobra.”
A hand-held biosensor device requires special antibody compounds known as probes in order to register the presence of a given hot agent. The probes are molecules that lock onto proteins in the hot agent. They change color as they lock on, and the biosensor device reads the color change.
“I hear you, Will. Let me start calling around. You stick to the investigation.”
Hopkins hung up. “Whew. Coffee. I need coffee.”
“Did you get any sleep last night?” Austen asked him.
“A couple of hours.” He went over to the electric coffee machine. The pot was empty. “I need some breakfast,” he said to Austen. “What about you? Hey, Suzanne! Breakfast?”
“I’m not hungry. I’ll eat later.”
Austen and Hopkins caught a helicopter up the East River. It let them off at the East Thirty-fourth Street Heliport. A few minutes later they were sitting in a coffee shop on First Avenue.
“A four-star breakfast, if you add in the airfare,” Hopkins remarked. It was an old-style coffee shop, with a short-order cook flipping eggs behind a stainless-steel counter, and a waitress who went around refilling disposable plastic cups in reusable holders.
Austen took a sip of coffee. She said, “How did you end up doing this?”
“What, Reachdeep?”
“You don’t seem like the type.”
He shrugged. “My father was in the Bureau.”
“Is he retired now?”
“No. He’s dead.”
“I’m sorry,” she said.
“He was a field agent in Los Angeles, where I grew up. He and a partner went to talk with an informant, and they walked into a murder in progress. One of the subjects panicked and opened fire through the door when they knocked. My father was hit in the eye. I was thirteen. I grew up hating the Bureau for taking my father away.”
“But—never mind.”
“You were going to ask me why I joined the Bureau?”
She nodded.
“I guess at some point I realized I was a cop, like my father.”
“You’re not a cop.”
“I’m a type of cop, and I’m scared this investigation isn’t going to work.” He looked at the table and played with a spoon.
“I don’t think we’ve diagnosed the disease yet,” she said. “The self-cannibalism. We can’t explain that.”
“You put an insect virus in a human system, you get a complicated result,” Hopkins said.
The waitress brought over a plate of fried eggs with bacon for Hopkins, and fruit and an English muffin for Austen.
“You need to eat more, Alice,” Hopkins said. “Bacon is good for you.”
She ignored him. “If we could just see through the disease, maybe we could see the person who’s spreading it.” Her voice trailed off.
“But we do have a diagnosis. It’s Cobra.”
“No. We don’t. Will, you’re looking at the genetic code. I’m looking at the effect of the virus on people. We don’t understand Cobra as a disease process. There is no diagnosis.”
“That’s a funny idea.” He took a slow sip of coffee, looking dismayed.
She thought: So many details to hold in your mind. If you could fit them together, the pattern would emerge. “Will,” she said. “How about the dust in the glue—the dust that James Lesdiu found? I’m wondering if it’s steel dust from the subway.”
“Steel dust? What’s that?” Hopkins asked. He loaded egg and bacon into his mouth. Traffic went past outside the window.
“Ben Kly showed it to me. It’s all over the subway tunnels. Two homeless men have died of Cobra, and they were neighbors living in a subway tunnel. I wonder if Archimedes lives in the subway.”
“Impossible,” Hopkins said. “You can’t do lab work in the subway. A virus lab has to be spotlessly clean, and you need some sophisticated equipment. You just couldn’t put that stuff in the subway.”
“If he had any steel dust on his fingertips, he might have spread some of it into the glue when he was making the box.”
“Sure. But a lot of people take the subway, and they probably get dust on their fingers. All the dust shows is that Archimedes took the subway the day he made the box. Big deal.”













