The Cobra Event, Page 20
Richard Preston
Felix began reading the DNA, but nothing came up on the screen. Felix was having some problems. Hopkins had to resist a temptation to bang Felix with his hand, the way you’d bang a television that isn’t working.
Just then Austen and Tanaka came in. Tanaka’s face was radiant, she was beaming, but holding back.
“I’m having trouble getting gene sequences here,” Hopkins said to them.
“Take a look at this,” Tanaka said. She laid the photographs in front of Hopkins.
“Whoa,” he said. He stared at the photographs, chewing bagel.
“These are particles we recovered from Glenn Dudley’s brain,” Suzanne Tanaka said.
“Midbrain. The part of the brain that controls primitive behavior, such as chewing,” Austen added.
“Look at the crystals, Will,” Suzanne Tanaka said. “See that blocky shape? This looks like the nuclear polyhedrosis virus, N.P.V., which lives in butterflies. It isn’t supposed to live in people.”
Hopkins stood up slowly, a look of wonder on his face. “It lives in people now,” he said. “My God, Suzanne! A butterfly virus. This is great!” He slapped her on the back. “Suzanne, you are the best!”
She looked very pleased. She didn’t say anything.
“All right!” Hopkins said. “All right.” Now he paced the room. He ran his hands over his face. “All right. What are we gonna do, guys? Are we going to tell Frank Masaccio we’ve got a butterfly virus? He won’t believe us. He’ll think we’ve gone lunatic.”
In biology, the shape of an organism may not tell you how it fits into the evolutionary tree of life. Many viruses look alike in a photoscope but are very different at the genetic level. “We need some genes,” Hopkins said. “We need a gene fingerprint. Felix is gonna prove this thing is a butterfly virus. I’m scanning genes already, but I haven’t put it together.”
He bent over the Felix machine, his hands flying, working like a madman.
Austen found herself watching Hopkins’s hands as he worked. His hands were muscular, but they were gentle and precise in their motions. There was no trembling, no hesitation, no spare or useless movement. His hands were in perfect control. These were trained hands, the hands of a gadgeteer. “I’m purging the system. We’ll try again.”
Using a micropipette, he put another sample of DNA into Felix. Still standing, he tapped the computer keys, and letters of text began to appear.
ttggacaaacaagcacaaatggctatcattatagtcaagtacaaagaattaaaatcgagagaaaacgcgttcttgtaaatgcctgcacgaggttttaacactttgccgcctttgtacttgaccgtttgattggcgggtcccaaattgatggcatctttaggtatgttttttagaggtatc
This was genetic code from somewhere in the DNA of the Cobra virus.
Molecules of DNA resemble a spiral ladder. The rungs of the ladder are known as the nucleotide bases. There are four types of bases, and they are denoted by the letters A, T, C, and G. (The letters stand for adenine, thymine, cytosine, and guanine—nucleic acids.) The length of the DNA in living creatures varies greatly. Human DNA consists of about three billion bases. That’s enough information to fill three Encyclopaedia Britannicas. All of this information is crammed into every cell in the human body. A small virus, such as the virus for the common cold, has only about 7,000 bases of DNA. Hopkins had made a guess that the Cobra was complicated and would probably contain around 50,000 to 200,000 bases of DNA.
Sometimes as few as a dozen bases of DNA code are enough to provide a unique fingerprint to a particular organism. You can use a computer program to match unknown code with known code. If you can make a match, then you can identify the organism the DNA came from. The process of matching unknown DNA code with known code is like the process of opening an unread book and reading a few lines from it. If the lines are familiar, then you can make a guess as to the book. For example, these words serve to identify a book: In the beginning God created the heaven and the earth. And the earth was without form, and void. The exact edition of the book (the “strain” of the book, so to speak) is the King James translation of the Bible in English.
As strings of letters marched across the screen, Hopkins hoped that he would soon have a better idea of what kind of book Cobra was.
gcaagcatttgtatttaatcaatcgaaccgtgcactgatataagaattaaaaatgggtttgtttgcgtgttgcacaaaatacacaaggctgtcgaccgacacaaaaatgaagtttccctatgttgcgttgtcgtacatcaacgtgacgct
The letters drifted in blocks across the screen. “Time to get on the Web,” Hopkins announced. He ran Netscape on one of the Felix laptops. His computer then socketed into the World Wide Web via the satellite dish sitting on the patio deck. In a few seconds, he arrived at a Web site known as GenBank. This site—it is in Bethesda. Maryland—has a huge database of genetic sequences. GenBank is the world’s central library of genetic codes.
Hopkins clicked a button on the screen. The GenBank computer looked at the code and began matching it to known genetic codes. Soon an answer came back:
Sequences producing High-scoring Segment Pairs:
Autographa californica nuclear polyh… 900 4.3e-67 1
Autographa californica nuclear polyh… 900 4.9e-67 1
Bombyx mori nuclear polyhedrosis vir… 855 2.4e-63 1
Bombyx mori nuclear polyhedrosis vir… 855 2.7e-63 1
It was a list of virus DNA codes that had shown close matches with the code that Hopkins had sent. The top line showed the closest match.
“Looks like we’ve got a rough identification of the Cobra virus,” Hopkins said. “That top line, right there, that’s the probable strain of the virus. That’s the closest match to Cobra.” His finger traced over
Autographa californica nuclear polyhedrosis virus
Cross section through a crystal of Autographa californica nuclear polyhedrosis virus. Magnification 25,000. (Electron micrograph courtesy of Dr. Malcolm J. Fraser, Jr., and William Archer, Department of Biological Sciences, University of Notre Dame.)
Cobra virus was similar to the nuclear polyhedrosis virus, or N.P.V. (It is also called the baculovirus.) This particular strain lived in a moth. The moth was Autographa californica, a small brown and white moth that lives in North America. The caterpillar of the moth is a crop pest, a green inchworm known as the alfalfa looper. The virus invades the moth caterpillar and kills it. Cobra was based on a moth virus, but it had been altered.
N.P.V. is a common virus used in biotechnology labs all over the world. It is available to anyone, and Hopkins’s heart sank as he thought about this. The virus was going to be devilishly hard to trace back to its original source. It made him wonder if his idea of a Reachdeep operation was already in trouble.
The crystals that Tanaka had photographed were actually crystals of protein, with virus particles embedded in them, like seeds in a watermelon. The protein is called polyhedrin, because it forms rounded crystals that look like soccer balls: polyhedrons.
The genes of N.P.V. can be changed easily without causing harm to the virus. Many viruses are difficult to change. They are too sensitive. If you change their genes, they stop working. But N.P.V. is a rugged, tough, flexible virus. It can be given foreign genes that change its behavior as an infectious agent. Hopkins knew enough about viruses to know this, and it chilled his blood to make the identification. He knew that buried somewhere in the code of the Cobra virus he would find engineered genes. Genes that had been put there, enabling the virus to replicate in human tissue, specifically in the central nervous system.
Cobra was a recombinant virus, or a chimera. In Greek mythology, the chimera was a monster with a lion’s head, a goat’s body, and a dragon’s tail. “The chimera,” Hopkins whispered, “was a tough monster to kill.”
He put a few more drops of sample liquid into Felix and started Felix on another run, pulling up more DNA code. Austen had finished her autopsies, and for the moment she did not have work to do. She suited up and went back into the Core to see what was going on there. Suzanne Tanaka went back to work with her microscope.
Signatures
IN THE CORE, James Lesdiu was running a forensic analysis of the physical materials used
in constructing the two boxes. They were bombs. All bombs, as Hopkins had so passionately maintained at the SIOC meeting, contain forensic signatures that can guide an investigator to the builder of the bomb.
Austen found Lesdiu sitting at a table in the center of the materials room, the cobra boxes before him under bright lights. He was holding an old-fashioned magnifying glass in one hand and a pair of tweezers in the other. His hands were enormous. They were covered with double rubber gloves.
“I’m dying inside this suit,” he confessed to Austen. He was dressed in an extra-large F.B.I. biohazard suit, and he looked extremely uncomfortable. His Racal hood was beaded with sweat on the inside. He had draped a towel over his shoulder—inside his hood. Now he shifted his shoulder, turned his head, and wiped the sweat off his face using the towel.
Lesdiu probed the tweezers here and there in one of the boxes.
“I’m looking for hair-and-fiber evidence,” he explained. Lesdiu plucked at something inside the box. “There’s another hair. It’s another Q.”
Austen had never heard the term Q.
Lesdiu explained that he had found some unknown human hairs. “They’re questioned hairs,” he said. “We call unknown samples Q evidence, or questioned evidence. It’s questioned because you don’t know what it is or where it comes from.” He had placed the hairs on a sheet of brown paper. “Samples are either questioned samples or known samples. The questioned samples are things that are found at the crime scene. Sherlock Holmes called them clues.” He smiled. “Qs are physical evidence. We analyze the Q samples, hoping to match them with something known. Forensic science is largely pattern recognition. The Qs are things like fingerprints, hair and fibers, blood, toolmarks, shoe prints, all kinds of trace evidence. DNA is trace evidence. The DNA of the Cobra virus that you’ve been looking at on the screens, that’s a questioned sample, because we don’t know where the Cobra virus comes from.”
Austen realized that this was very similar to what she had been doing in the beginning, when she had traced the outbreak to the boxes. “You guys are doing a diagnosis of a crime.”
“In a way, yeah,” Lesdiu said.
The F.B.I. maintains enormous reference collections of known samples of all kinds of objects. These are called reference knowns. “If you can match a fingerprint, you can get a conviction,” Lesdiu said. “Because a fingerprint pattern is unique. But forensic evidence is not always so clear. That’s why you usually need a lot of it.”
Lesdiu put his tweezers down. He was taking a break. “I’ve got two hairs so far,” he said. They come from the Zecker-Moran box. One is a fine, reddish hair, with an oval shaft, Caucasian.”
“That sounds like Kate’s hair,” Austen said.
“It probably is,” Lesdiu said. “Frank Masaccio’s folks are getting some known hair samples from her bedroom. As soon as they arrive, I can start comparing Qs and Ks. The other hair is oval and transparent. It’s a gray hair from a Caucasian.”
“Penny Zecker,” Austen said.
“Maybe. We’ll be getting hair samples from her house too. I also found some wool fibers. Black. Maybe from a sweater—maybe the girl’s sweater, maybe not. The other box, the one the homeless guy carried around with him—” Lesdiu indicated the Harmonica Man box, which was sitting beside the Zecker-Moran box. “This one has a ton of fibers all over it and in the cracks. The fibers are cotton and polyester. The box was wrapped up in the guy’s clothes. I have to say that anyone who was smart enough to load this box with a virus is smart enough not to leave any hair or fibers on it. This fiber analysis is not going to pan out. My bones are telling me that. But there’s more than one way to skin a cat. There’s a ton of microscopic evidence in these boxes.”
JIMMY LESDIU had set up a row of machines in the materials room. One of them could throw a beam of infrared laser light on an object and then analyze the spectrum of the light bouncing off the object. The machine gave information about what the sample was made of. It could also see invisible fingerprints on a surface. Lesdiu had also set up a machine that could vaporize a sample and identify the atoms in the gas coming out of the sample.
Lesdiu found a number of fingerprints on the boxes. He photographed them in laser light and sent the images by satellite to Washington, where the fingerprints would be analyzed. Later, it would turn out that none of the fingerprints belonged to the Unsub. They belonged to Kate Moran and Penny Zecker. The Unsub had been much too careful to leave fingerprints.
A shiny black enamel had been used to paint the design on the box. With the infrared laser, Lesdiu got a spectrum of colors from the paint. To the human eye, the paint was black, but to the laser it was a rainbow of colors. Lesdiu passed the paint spectrum on to Washington, and within minutes an F.B.I. expert in paint called him back on the telephone. The call came into the hot Core on a speakerphone, since you can’t use a telephone handset if you are wearing a Racal hood.
“You folks in Forensics must be standing around waiting for me to call,” Lesdiu shouted on the speakerphone to his paint expert.
“We’ve been told to respond quickly. Frank Masaccio will kill us if we don’t.” The paint expert went on to say that the paint was a common enamel model paint. It was sold in hobby shops everywhere.
The signature had petered out into a maze of common objects. This was typical of signatures. Still, the paint was a Q that could be tied to a K, if a suspect turned up with enamel model paint.
The cobra boxes had bits of paper glued to them, on which words were written—Archimedes’ name and the date. The bits of paper were glued to the box with a clear, flexible glue. With a razor blade, Lesdiu cut away a tiny shred of the glue. “It’s kind of a rubbery glue,” he said. “I’d say it’s a silicone glue or a hot-melt type of glue.”
He dropped a bit of the glue from the knife onto a glass slide, ran it through the laser machine, and got some data. “I got a real nice infrared spectrum of this glue. Look at that, isn’t that beautiful?” he said.
Alice Austen stared at the screen. It was a meaningless jagged line to her. She told Jimmy Lesdiu as much.
“There’s information in these peaks and valleys,” he said.
“If you looked at a cell, you wouldn’t see much in it,” she said to him. “I would see a world.”
There was a man at F.B.I. headquarters who could see a world in a drop of glue. They called him the Maven of Glue. James Lesdiu sent the spectrum of the glue over an encrypted satellite link to the F.B.I. forensic lab at headquarters in Washington, meanwhile talking on his speakerphone to the scientist known as the Maven of Glue. The Maven put Lesdiu on hold for a few minutes, and then said to him, “Okay, Jimmy, I’ve checked the spectrum against our library of adhesives. You are not going to be happy, Jimmy.”
“I’m listening,” Lesdiu said, standing by the speakerphone.
“The spectrum you sent is consistent with a silicone glue made by the Forkin Chemical Company in Torrance, California. It’s called Dabber Glue. They sell millions of tubes of this stuff. You can buy it in any hardware store. I really like it. It’s a nifty glue. I use it myself at home.”
Austen said, “Why doesn’t somebody call Forkin Chemical?”
Lesdiu shrugged. “That would probably be useless. They can’t trace millions of tubes.” Nevertheless, he called Frank Masaccio with the information, and an F.B.I. agent got in touch with the president of Forkin Chemical. The agent and the company president had a very pleasant conversation, and the president called an emergency meeting of his technical people and his top sales staff for the northeastern United States. But in the end, there was nothing the management of the company could do to help narrow down the retail source of the glue. The company said that there were at least three hundred retail-outlet stores in the New York area that would be selling Dabber Glue. And of course the Unsub might not have bought the glue in the northeastern United States. The glue was sold everywhere.
Lesdiu held the box in his long fingers, squinting at it. He looked at it wit
h his Sherlock Holmes hand-magnifying lens. He found some kind of black, powdery dirt embedded in the glue. Very fine particles of dirt, jet black.
“I’m going to nail this dirt,” Jimmy Lesdiu said.
He had to separate a few particles of dirt from the glue, and silicone does not dissolve in most solvents. But after a further conversation with the Maven of Glue and with chemists at headquarters, Lesdiu came up with a solvent that would work. He rooted in one of the supply boxes, shuffling through bottles, until he found what he was looking for. Then he dissolved a bit of the glue in a small test tube, and swirled the particles. A blackish, brownish haze hung in the liquid. Now he had to separate the particles. He returned to a supply box and found a magnet He held the magnet against the test tube. The black dust drifted toward the magnet. “It’s a ferromagnetic material. It’s iron or steel,” he said. But the brown haze did not move under the magnet. The brown haze was probably an organic material or rock or concrete dust. Lesdiu had separated the dirt into two components—a black dust and a brown haze.
“I’ve done an autopsy on a terror device,” Lesdiu remarked to Austen.
But now he had reached the end of what was possible with a Reachdeep portable operation. The sample of dust had to go to the F.B.I. metallurgists in Washington, who would continue the analysis. Into the test tube of dusts he dropped a strong disinfectant—to sterilize the contents, just in case it contained any live Cobra virus particles. A few minutes later, a Bell turbo helicopter took off for Washington bearing the test tube. The team would have to wait several hours, at least, before the F.B.I. metallurgists could tell what the black dust was. The particles might contain information, but whether that information would constitute a signature that could lead back to the perpetrator, no one knew.













