Larger Font   Reset Font Size   Smaller Font  

Spiral

Kōji Suzuki


  An assistant professor came to the phone, and Ando asked him if there had been any patients who'd died late last month from heart attacks caused by blockage of the coronary artery. The man responded with a curt question of his own. "Sorry, but what are you getting at?" Ando explained to him that they had seen seven deaths from the same cause in the greater Tokyo area, and there were indications that there could be many more victims. He avoided any mention of paranormal phenomena.

  This didn't seem to have assuaged the man's doubts. "So you're contacting medical schools across the region?"

  "No, not exactly."

  "So why are you calling us?"

  "Because your area is at risk."

  "Are you saying we're going to find bodies in Utsunomiya?"

  "No, in Ashikaga."

  "Ashikaga?" The mention of the name startled the man. He fell silent, and Ando could almost sense his grip on the receiver tightening.

  "This is a shock. I can't imagine how you know about it. As a matter of fact, on October 28th, the bodies of an elderly couple were discovered there. We did autopsies on them the next day."

  "Can you tell me their names?"

  "Their last name was Oda, I think, and the wife's name was Setsuko. I forget the husband's name."

  Ando had already checked on Shizu Asakawa's parents' names: Toru and Setsuko Oda. It had to be them. Now they had proof. On the morning of October 21st, Asakawa had loaded a VCR into his rented car and driven to his in-laws' house in Ashikaga, where he'd had two copies made of the tape and shown to the old couple. No doubt he'd assured them that if they made more copies and showed them to other people within a week, their lives wouldn't be in any danger. They probably hadn't needed much convincing, regardless of whether or not they fully believed in their son-in-law's outlandish story. If there was any chance that their daughter and granddaughter's lives were on the line, they must have been more than willing to acquiesce. And so Asakawa had had copies made, believing that by doing so he'd saved his wife and child. But on the way home he lost them both at once, and then a week later, the old couple died, too.

  "I'll bet you were pretty surprised by what you found in the autopsy." Ando could well imagine the staff's shock at finding the same symptoms in both bodies.

  "You can say that again. I mean, given the simultaneous time of death, plus the fact that they left a note, we naturally assumed it was a double suicide. But then we cut them open, and found, instead of poison, strange tumors in their coronary arteries. Surprised isn't the word."

  "Hold on a minute," Ando broke in.

  "What?"

  "You say they left a note?"

  "Yes. It wasn't much of one, but a note was found next to their pillows. It looked like they'd written it right before they died."

  Ando was disconcerted by this development. What did this mean? Why did they leave a note?

  "Can you tell me what the note said?"

  "Hang on." The assistant professor put down the receiver, but was back a few seconds later. "It's going to take me a while to locate it. Shall I fax it to you later?"

  "I'd appreciate that."

  Ando told the man his fax number and then hung up.

  He couldn't leave his desk after that. The fax machine was on the middle shelf of a computer cabinet two desks away. He swiveled in his chair forty-five degrees to face the fax machine, and then waited for the transmission to arrive.

  He couldn't relax; he couldn't even lean back in his chair. Instead, while he waited, he went over the course of events up to now in his head. Reviewing the past was all he could do. He was too distracted wondering when the fax machine would come to life to start a new train of thought.

  Finally, the machine started to buzz and a fax began to roll out. He waited until it was finished, then got up and tore it off. He returned to his seat, spread the fax open on his desktop, and read:

  To: Dr Ando, Fukuzawa University Medical School

  Here's the note Mr and Mrs Oda left. Please let me know of any new developments.

  Dr Yokota

  Medical School

  Joji University

  Under the professor's scrawled note were a few lines of text accompanied by the Odas' names. The handwriting wasn't Yokota's; he must have made a photocopy of the original.

  October 28, morning

  We took it upon ourselves to dispose of the videotapes. There's nothing more to worry about. We're tired. Yoshimi and Kazuko, please take care of everything.

  Toru Oda

  Setsuko Oda

  The message was short, but even so it was enough to make it clear that they knew they were facing death. Yoshimi and Kazuko were probably their other two daughters. But who had the previous sentence been addressed to?

  What did they mean, they'd disposed of the videotapes?

  Did it mean they'd gotten rid of them? It certainly couldn't be taken to mean that they'd copied them.

  Ando decided to try and recreate the Odas' state of mind from the beginning.

  On Sunday, October 21st, their son-in-law showed up on their doorstep and told them that Shizu and Yoko's lives were threatened by a curse embedded in a videotape. The Odas agreed to copy the tape. But then, that same day, Shizu and Yoko died at the time foretold. Even if the Odas had been skeptical about Asakawa's story at first, now they surely had to believe in the video's power. Then, after the funeral, they had learned the results of the autopsies: inexplicable heart attacks. At this point the Odas must have decided to give up hope of saving themselves. Their daughter and granddaughter had lost their lives in spite of the fact that they'd followed the videotape's demands. The Odas must have thought that they couldn't escape death no matter what they did. Exhausted from all the effort that had gone into the funerals, and perhaps weary of life in general, they decided to refrain from copying the videotape and meekly awaited the approach of death. But if their note was to be believed, while waiting, they had "disposed" of the videotapes that were the source of all this misery.

  There was no way for Ando to know how they had disposed of the tapes. They might have erased them completely and then thrown them away, or they might have buried them in the yard. In any case, as Ando now attempted to diagram the video's path on a piece of scratch paper, he decided to grant for the moment that those two copies had been obliterated.

  First there had been the one in Villa Log Cabin No. B-4, the source of all the evil, created when a VCR left to record had captured the images on tape. Asakawa had taken that back to his apartment and made a copy for Ryuji. At this point there were two copies, two strains as it were. However, it seemed that Ryuji's copy had found its way into Mai's hands, and had then been erased, all except for the first ten seconds. Asakawa's copy, meanwhile, had passed to his brother Junichiro, who had discarded it along with the damaged VCR. Asakawa's original had begotten two further strains in the form of copies given to the Odas, but these too had been disposed of. In short, the videotapes born of Sadako Yamamura's wrath had now vanished from the face of the earth.

  Ando went over the tree he'd constructed again and again, to make sure he had it right. But the tape did indeed seem to have gone extinct. A mere two months after it had come to life at the end of August, having claimed only nine victims, the scourge had died out. But… Ando thought. If the videotape killed everybody who watched it regardless of whether or not they copied it, it was obvious that it was going to go extinct sooner or later. Only by virtue of its threat would it be able to reproduce itself, to adapt to its environment and survive. Once the threat was exposed as a lie, the tape would inevitably be driven into a corner.

  If it was extinct, that would mean they'd seen the last of these mysterious deaths. If nobody else could be exposed to those images, then there was no fear of anybody dying from inexplicable heart attacks. But a fundamental point now stole back into Ando's mind.

  Why is Asakawa still alive?

  This was followed by another question.

  Where is Mai Takano?

  Logical
ly, the videotape seemed to have died out. But Ando's intuition denied it. This wasn't going to be over that easily. Something didn't sit right.

  3

  Ando picked up a locker key at the front desk of the library, and then took off his jacket on his way to the lockers. It was almost winter. Anybody who saw him, wearing nothing but a shirt, would shiver in sympathy. But Ando perspired easily, and even in his shirtsleeves, he felt hot in the climate-controlled library. He took a pen and a notebook out of his briefcase, then wrapped his jacket around it and stuffed it in a locker.

  The notebook was where he'd put the page containing the DNA analysis of the virus found in Ryuji's blood. Ando was determined to have a go at cracking the code today, which was why he was here in the library first thing in the morning, but the moment he looked at the meaningless array of letters on the printout, his eyes glazed over. There was no way he'd be able to figure this out. But when he thought about it, he recalled that he was doing this partly to kill time. He couldn't think of anything better to get him through the empty three-day weekend.

  So he tucked the notebook under his arm and headed up to the third-floor reading room, where he took a seat by the window.

  As a student playing at cipher-cracking with Ryuji, he'd had quite a collection of books on cryptography at home. But what with getting married and then getting divorced, he'd moved three times since then, not to mention the fact that he'd lost interest in the subject; all those books had disappeared somewhere along the line. There were certain types of codes that he couldn't hope to decipher without the help of character substitution charts and letter-frequency graphs of the kind found in specialist works, and he doubted he'd be able to get anywhere on this one without their help. And since it just seemed foolish to buy them all over again, he'd ended up at the library.

  At one point he'd had a good grasp of the basics of constructing and unscrambling codes, but it had been ten years, so he first took a quick glance through a primer on the subject. He decided that his first step should be to decide just what class of code was contained in the smallpox-like virus's base sequence.

  Codes can be generally divided into three types: substitution ciphers, in which the letters of the message are replaced by other letters, symbols, or numbers; transposition ciphers, in which the order of the words of the message is changed; and insertion ciphers, in which extraneous words are inserted between the words of the message. The numbers that popped out of Ryuji's belly after the autopsy, which Ando was able to link to the English word "ring", was a good example of a simple substitution cipher.

  It didn't take him long to guess that the virus's code had to be of the substitution variety. What he had to work with was a group of four letters, ATGC, corresponding to the four bases, so it was most likely that the code consisted of assigning a particular character to a predetermined grouping of letters. That was most code-like.

  Code-like. When the thought occurred to him, it made him sit up and think. The essential purpose of a code is to convey information from one party to another without any third party being able to figure it out. As students, codes had been nothing but a game to them, brain-teasers. But in, say, times of war, when a code's susceptibility to deciphering could sway the tide of a conflict, a "code-like" code would mean one which was, in effect, too dangerous to use. In other words, one way to keep the enemy from breaking your codes was to make sure they didn't look like codes at first glance. If you caught an enemy spy and found he was carrying a notebook filled with suspicious looking strings of numbers, it would be a safe bet that it was top-secret informatin, encrypted.

  Even allowing for the possibility of decoys, when a code is identified as such, the chances of it being broken rise significantly.

  Ando tried to think logically. If the purpose of a code is to keep information from the hands of a third party, then a code should only seem "code-like" to the person for whom the information is intended. Staring at the forty-two letters interpolated into the base sequence of the virus, Ando found them extremely code-like. That had been his impression from the very first time he'd looked at the chart.

  Now why would that be?

  He tried to analyze the source of that impression. Why did it seem code-like to him? It wasn't as if there had never been puzzling repetitions found in the course of DNA sequencing. But in spite of that, this particular repetition seemed meaningful. It popped up everywhere they looked in the sequence, no matter where they sliced it. It was as if it was trying to call attention to itself, saying, I'm a code, dummy. The sequence of letters seemed particularly code-like to Ando in light of his experience with the numbers that had popped out of Ryuji's belly. In other words, maybe there had been two purposes to the word "ring" squeezing its way out just then: not only was it meant to alert Ando to the existence of the Ring report, but it was also a form of warning. It was as if Ryuji were telling him, I may use codes again as the situation warrants, so keep your eyes peeled and don't miss them. And maybe he'd used the simplest kind of substitution cipher as a hint, too.

  Given that the mysterious string of bases had only been found in the virus drawn from Ryuji, it was safe to assume that he was the one sending the code. It was an undeniable fact, of course, that Ryuji had died and his body been reduced to ashes, but a sample of his tissue still remained in the lab. A countless number of instances of his DNA, the blueprint for the individual entity that was Ryuji, still remained in the cells in that tissue sample. What if that DNA had inherited Ryuji's will, and was trying to express something in words?

  It was a nonsensical theory completely unworthy of an anatomist like Ando. But if he did succeed in making the string of letters yield words by means of substitution, then that would trump all other readings of the situation. Theoretically, it was possible to take DNA from Ryuji's blood sample and use it to make an individual exactly like Ryuji-a clone. This assemblage of DNA sharing the same will had exerted an influence over the virus that had entered its bloodstream, inserting a word or words. Ando could suddenly sense Ryuji's cunning and sheer genius behind this. Why had he inserted the message only into the virus, an invader, and not into his red blood cells? Because, with his medical background, Ryuji knew that there was no chance that DNA from the other cells would be sequenced. He'd known that he could only count on the virus responsible for the cluster of deaths being run through a sequencer, and so he'd concentrated his efforts on the virus's DNA. So that the words he sent would be received.

  All of which finally led Ando to one conclusion. Since this code looked to him like a code, it was no longer functioning, in essence, as a code should. Rather, it was just that Ryuji's DNA had no other way to communicate with the outside. The DNA double helix was composed of four bases represented by the letters ATGC. Ando couldn't think of any other way for it to make its will known but by combining those four letters in various ways. It had chosen this way because there was no other available to it. It was the only means Ryuji had at his disposal.

  Suddenly all the despair Ando had felt a few moments ago was gone, replaced by a buoying confidence.

  Maybe I'll be able to decipher this after all.

  He felt like shouting. If Ryuji's will, lingering in his DNA, was trying to speak to Ando, then it stood to reason that the words it used would be ones easy for Ando to decode. Why should they be more difficult than they needed to be? Ando went back and checked his line of reasoning to see if there were any holes in his deductions. If he started off on the wrong foot, he could wander around forever without finding the answer.

  He no longer saw what he was doing as merely a way of killing time. Now that he felt that he would actually be able to decipher the message, he couldn't wait to find out what it said.

  The rest of the morning, until lunchtime, Ando spent working on two approaches.

  The sequence he had to work with was:

  ATGGAAGAAGAATATCGTTATATTCCTCCTCCTCAACAACAA

  The first question was how to divide the letters up. He tried dividing them up in twos an
d in threes. First, by twos:

  Taking a pair of letters as one unit, the four letters available yielded a possible sixteen different combinations. He wondered if each combination might represent one letter.

  But this immediately led him to another problem: what language was this message written in?

  It probably wasn't the Japanese syllabary. There were nearly fifty characters in that, far more than the sixteen allowed by the pair method. The English and French alphabets both had twenty-six letters, while Italian only used twenty. But he also knew he couldn't overlook the possibility that the message was in romanized Japanese. Identifying the language of a code is sometimes half the battle.

  But this was a problem that had already been solved for Ando. The fact that he'd been able to replace the numerals 178136 with the word "ring" could probably be taken as a hint from Ryuji that the present code would also yield something in English. Ando was sure of this point. And so the question of language was as good as settled.

  The forty-two base letters could be split into twenty-one pairs. But several pairs were identical: there were four AA's, three TA's, three TC's, and two CC's. There were only thirteen unique pairings. Ando jotted these numbers down on a piece of paper and then paged through a book on code-solving until he found a chart showing the frequency of appearance in English of different letters of the alphabet.

  He knew that although the English alphabet contains twenty-six letters, not all of them occur in equal numbers in everyday use. E, T, and A, for example, are common, while Q and Z might appear only once or twice per page. Most handbooks on code-breaking will include various kinds of letter frequency charts in the back, among other statistical references. Using such tables and statistics made it easier to determine the language a coded message was in.