Spiral
Kōji Suzuki
Those who have viewed these images are fated to die at this exact hour one week from now. If you do not wish to die, you must follow these instructions exactly. Make a copy of this videotape and show it to someone else.
In that light, things made sense. The day after he'd watched the videotape, Asakawa showed it to Ryuji, and he also made a copy for him. Without realizing it, he'd helped the virus propagate. But Ryuji never made a copy.
Sure he had the answer, Asakawa had loaded a VCR into the rented car and driven off somewhere. Undoubtedly he'd planned to make two copies of the video and show them to two other people-one for his wife, and one for his baby girl. The people he showed it to would then have to find new prey, someone else to give a copy of the video to. But that wasn't the immediate problem. The important thing was to save the lives of his wife and child.
But just at the height of his relief at having saved the lives of his loved ones, Asakawa had reached into the back seat and touched his wife and daughter and found them cold. He lost control of the car.
Ando felt he could understand Asakawa's catatonic state now. Not only was he devastated at the loss of his family, but he was no doubt also tormented by a question: what was the true nature of the charm? Every time he thought he had it figured out, the answer slipped through his fingers, transforming itself, claiming another life. Rage and sorrow, and an endless repetition of the question: Why? Why was he still alive?
Ando put the manuscript pages in a pile on the table. Then he asked himself: Do you really believe this cock-and-bull story?
He shook his head.
I just don't know.
He didn't know what else to say. He'd seen the unnatural sarcoma on Ryuji's coronary artery with his own eyes. Seven people were dead of the same cause. In their blood had been found a virus that closely resembled smallpox. And where had Mai disappeared to? What about that odd ambience in her apartment, which she had seemingly vacated? That hair-raising intimation he'd had that something was there? The traces left on the videotape still in her VCR? Was the tape still propagating? Would it continue to claim new victims? The more he thought, the more questions Ando had.
He turned off the word processor and reached for the whiskey on the sideboard. He knew he wouldn't be able to sleep tonight without the help of alcohol.
12
Ando first dropped by the biochem lab and returned the word processor to Ueda, and then headed to the Pathology Department. Under his arm he carried the report he'd printed out the night before. He intended to let Miyashita read it.
Miyashita sat with his head down low to the table, scratching away with a ballpoint pen. Ando dropped the report on the tabletop next to him, and Miyashita looked up in surprise.
"Listen, would you do me a favor and read this?"
Miyashita just stared back at Ando in amazement.
"What's going on?"
"I want to know what you think of that."
Miyashita picked up the document. "It's pretty long."
"It is, but there are things in there that will interest you. It won't take long to read."
"You're not about to tell me you've been writing a novel in your spare time, are you?"
"Kazuyuki Asakawa wrote up a report about the deaths."
"You mean, our Asakawa?"
"Right."
Miyashita looked interested now as he flipped through some of the pages. "Hmm."
"So, there it is. Let me know what you think when you're done."
Ando started to leave, but Miyashita called him back. "Hold on a minute."
"What?"
Miyashita rested his cheek on his hand and tapped the table with the tip of his pen. "You're pretty good at codes, aren't you?"
"I wouldn't say I'm particularly good at them. In med school, some friends of mine played around with them, but that's about it."
"Hmm," said Miyashita, still tapping on the table.
"Why?"
Miyashita took his elbow off the printout he'd been looking at and slid it over to Ando. "This is why." He started tapping his pen on the center of the page. It was the printout he'd seen the day before, the results of sequencing the virus found in Ryuji's blood.
"You showed me this yesterday."
"I know, but I just can't get over it."
Ando picked up the piece of paper and held it up in front of his face. Into several points in an otherwise unordered sequence of bases, a string of bases in the same order had been inserted.
ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA
No question, it was strange for the same string of forty-two bases to appear several times at appropriate intervals.
"And Ryuji's virus is the only one like this?"
"Right. His is the only one with these extra forty-two bases," Miyashita said, his gaze not wavering from Ando's. "Doesn't that strike you as weird?"
"Of course it does."
The tap-tap of the ballpoint pen ceased.
"The thought crossed my mind that it might be a sort of code."
Ando gulped. He couldn't remember having told Miyashita anything about what had happened after Ryuji's autopsy. Not about the corner of newspaper, and certainly not about the fact that he'd come up with the word "ring" from it. And yet now Miyashita was talking about codes.
"Assuming it is a code, who's sending it?"
"Ryuji."
Ando screwed his eyes shut. The idea was one he'd been desperately trying to avoid entertaining, and now Miyashita was shoving it in his face.
"Ryuji's dead. I performed the autopsy myself."
Miyashita didn't seem fazed in the least. "Well, whatever. Just see if you can decipher this, okay?"
Was it really possible that the sequence of bases could be somehow turned into a word? Just as the digits 178136 had quickly yielded RING, maybe these forty-two letters could be made to form words. Maybe they did carry some important message. Had Ryuji himself, from beyond the grave, inscribed this over and over in his own remains?
Ando's hand, clutching the printout, trembled as he felt himself being driven into the same blind alley as Asakawa. But there was no way he could refuse Miyashita's outright request. The idea that it might be a code had occurred to Ando, too, the first time he'd seen the sequence, but he'd buried the thought in the depths of his brain. He was afraid that if he didn't, the scientific framework on which he'd hung his life would be bent further out of shape. Things were threatening to go beyond his ability to absorb them.
"You can keep that. Take your time and see what you can do with it."
Miyashita was supposed to be a scientist. Ando couldn't understand how he could bandy about these unscientific ideas so readily.
"I have faith in you. You'll figure it out," said Miyashita, giving Ando a pat on the butt.
PART THREE - DECODING
1
Ando and Miyashita followed the waitress to a table by the window. The restaurant was on the top floor of the university hospital and boasted a fantastic view of the Outer Gardens of Meiji Shrine. In addition, university employees got a discount. Both men had taken off their lab coats before coming, but still the waitress could tell at a glance that they weren't members of the general public visiting a patient. She handed them the special employees' lunch menu. Merely glancing at it, both Ando and Miyashita ordered the special of the day and coffee.
As soon as the waitress left, Miyashita said, with a portentous air, "I read it." From the moment Miyashita had asked him to lunch, Ando had known he'd start out with that phrase. Miyashita had read Asakawa's Ring report and was now ready to comment on it.
"So what did you think?" Ando leaned forward.
"I won't lie. I was amazed."
"But do you believe it?"
"Hell, it's not a question of belief. It all adds up. The names of the victims and the times of death he gives check out. We've seen the incident reports and the autopsy records ourselves, you and I."
He was right, of course. They had copies of the coroner's reports and
associated documents for the four victims who'd been at Villa Log Cabin. The times of death given therein accurately reflected what Asakawa had written. There were no inconsistencies to be found. But what took Ando aback was how a pathologist as sharp as Miyashita showed no apparent resistance to the idea of curses and supernatural powers playing a role in all this.
"So you just accept it?"
"Well, it's not as if I don't have reservations. But, you know, when you really think about it, modern science hasn't managed to come up with answers to any of the most basic questions. How did life first appear on earth? How does evolution work? Is it a series of random events, or does it have a set teleological direction? There are all kinds of theories, but we haven't been able to prove one of them. The structure of the atom is not a miniature of the solar system, it's something much more difficult to grasp, full of what you might call latent power. And when we try to observe the subatomic world, we find that the mind of the observer comes into play in subtle ways. The mind, my friend! The very same mind which, ever since Descartes, proponents of the mechanistic view of the universe considered subordinate to the body-machine. And now we find that the mind influences observed results. So I give up. Nothing surprises me. I'm prepared to accept anything that happens in this world. I actually kind of envy people who can still believe in the omnipotence of modern science."
Ando himself had at least a few doubts about the so-called omnipotence of modern science, but evidently they weren't as grave as Miyashita's. How could one feel comfortable in the scientific community if one harbored that kind of skepticism?
"That's pretty extreme."
"I've never told you this, but I'm actually a philosophical idealist."
"An idealist, huh?"
"Like the Buddha said, form is empty and emptiness is form."
Ando wasn't quite sure what Miyashita was trying to say. He was sure that between philosophical idealism and reality is empty there was a lot being left unsaid, but now wasn't the time to pursue the finer points of Miyashita's worldview.
"Anyway, was there anything that particularly bothered you about the report?" Ando wanted to see if he and Miyashita harbored the same doubts about it.
"Oh, any number of things bothered me." The coffee arrived, and Miyashita stirred his full of cream and sugar. His ruddy face caught the sun full-on through the window. "First, why is Asakawa and only Asakawa still alive after having seen that videotape?"
Miyashita took a sip of coffee.
"It's because he figured out the charm, no?"
"The charm?"
"You know, the part that had been erased at the end of the tape."
"The bit that wanted to force the viewer to do something."
"So if Asakawa did it without realizing it…"
"Did what?"
"It was right there at the end of the report, wasn't it? 'The nature of a virus is to reproduce itself. The charm: make a copy of the video.'"
Then Ando explained to Miyashita a few things he didn't know. There had been a video deck in Asakawa's car at the time of the accident, and Ando had found a taped-over copy of the videotape in Mai's apartment.
A light seemed to go on in Miyashita's head. "A-ha, so that's what he meant. Asakawa thought the charm was to make a copy of the video and to show it to someone who hadn't seen it yet."
"I have no doubt that's what he thought."
"So, where was he heading with the VCR on the morning of the accident?"
"Someplace where he could find two people who would watch the tape, of course. He must have been desperate to save his wife and young daughter."
"But he'd have had a hard time showing such a dangerous tape to a complete stranger."
"I imagine he went to his wife's parents. It couldn't have been his own parents, since his father's still alive and well. I spoke to him on the phone just the other day."
"So her parents exposed themselves to a temporary risk in order to save their daughter and granddaughter."
"Looks like we need to find out where they live and check with the local police."
If the video, complete with extortionate addendum, had been reproduced and circulated, then there might well be more victims in the area around Shizu Asakawa's parents' house. But if there were, the media hadn't picked up on them yet. The video's progress was still below the surface, out of the public eye.
Miyashita, too, seemed to have arrived at the thought that the videotape had the ability to spread like a virus. He spoke mockingly. "Looks like you'll be cutting up a lot of bodies."
This jolted Ando into a realization. Judging from the situation, it was more than likely that Mai had watched the tape. It was now almost two weeks since she'd disappeared. Perhaps he'd end up dissecting her himself. He imagined her beautiful form on the operating table, and it horrified him.
"But Asakawa's still alive." He said it like a prayer.
"The biggest problem we have is this: if Asakawa did manage to make two copies of the videotape, why did his wife and daughter die?"
"Put another way, why is Asakawa himself still alive?"
"I don't know. The smallpox virus is tangled up in this, right? In light of that, it makes perfect sense for this 'charm' to be copying the video to help it propagate."
"It makes sense up through Ryuji's death. But the deaths of Asakawa's wife and daughter throw the question wide open all over again."
"So, being copied wasn't what the tape wanted?"
"I don't know."
He didn't know how to interpret the situation. Either the charm had aimed at something else, or something untoward had happened in the copying process. Or maybe the tape killed people who watched it regardless of whether or not they enacted the charm. But that would make it even harder to explain why Asakawa survived.
Lunch arrived, and the two men fell into silence for a while, absorbed in eating.
Finally, Miyashita rested his fork and said, "I find myself in a dilemma."
"What do you mean?"
"Well, if there is such a videotape, I'd want to watch it. But it might kill me. I'd say that's a dilemma. A week's not much time."
"Not much time?"
"To figure it out. It's really intrigued me. Scientifically speaking, what we have here is a video, a medium that attacks the human brain through its sense of sight and sound, which can somehow implant a smallpox-like virus inside the body."
"Maybe it wasn't that it implanted it. Maybe the images on the video somehow influenced the victim's cellular DNA so that it metamorphosed into the mystery virus."
"You might have something there. I'm thinking of the AIDS virus. We don't know its origins for sure yet, but it's thought that something caused human and simian viruses that had existed all along to evolve, and that's what gave birth to the AIDS virus as we know it. In any case, AIDS is not a virus that has been around for hundreds of years. Analysis of its base sequences clearly shows that it's something that branched into two strains only about a hundred and fifty years ago. Through some chance event."
"And you want to find out what that chance event is in this case."
"Me, I think it involves the mind." Miyashita leaned forward until his nose almost touched Ando's.
It was, of course, common knowledge that the mind, as abstract and immaterial as it was, could influence the body in various ways. Ando was well aware of this. One only had to think of how stress could eat holes in the stomach lining. Now Ando and Miyashita were thinking along the same lines. First, the video created in the viewer a particular psychological state that somehow influenced the viewer's own DNA to metamorphose until the mystery virus which resembled smallpox was born. Then, this smallpox-like virus caused a cancer inside the coronary artery that surrounds the heart, resulting in a tumor. In a week's time the tumor reached its peak size, cutting off the flow of blood and stopping the heart. But the virus itself was like a cancer virus-its function was to worm its way into the DNA and cause cellular mutation in the coronary arteries tunica media-and wasn't
very contagious. At least, that was what their analysis so far had led them to think.
"Come on, don't you want to see it?" challenged Miyashita.
"Well…"
"I just want to get my hands on that tape."
"No, I think it's best to let sleeping dogs lie. You'd end up like Ryuji."
"Speaking of Ryuji, did you manage to break the code?"
"Not yet. Even if it is a code, forty-two bases is too small a number to work with. It could only contain a few words at most."
This was an excuse. Ando had in fact tried several times to decipher the code, but every attempt had ended in failure.
"I guess I know how you'll be spending your holiday."
That was when Ando first realized that the next day was a national holiday, Labor Thanksgiving Day. And since he didn't have to work the following day, Saturday, it meant he had a three-day weekend coming up. Ever since losing his son and his wife, he hadn't paid much attention to holidays. It was nothing but misery to be home alone, and three-day weekends that he had no plans for made him particularly depressed.
"Yeah, well, I'll give it a shot."
But spending the holiday trying to read a coded message from a dead man sounded pretty dismal. On the other hand, if he succeeded, then maybe it'd give him some sense of accomplishment. At least it would provide a distraction.
So he promised Miyashita that he'd have it figured out by the end of the weekend. "On Monday, I'll tell you what Ryuji's trying to say."
Miyashita reached across the table and clapped a hand on Ando's left shoulder. "It's up to you now."
2
After lunch, Ando went back to his office and put in a call to the Forensic Medicine Department of Joji University Hospital, in Utsunomiya, Tochigi Prefecture. A little research had turned up the information that Asakawa's wife's parents lived in Ashikaga, Tochigi. Any unexplained deaths in that region would fall under the jurisdiction of the doctors at Joji.













