"Ah-ha."
Yoshino faced Ando again, this time with a bitter expression. "I just don't know where it is. I couldn't find it in his apartment." Having said this, he stared off into space.
Asakawa was hospitalized, and his wife and daughter were dead. The apartment was empty. Was Yoshino saying he'd broken in and searched it? "His apartment?"
"Yeah, well, the building manager's an old softie. All I had to do was come up with a good excuse, and he let me right in with the master key."
It was the same thing Ando himself had done just the other day, out of concern for Mai, so he knew he couldn't criticize Yoshino's behavior. The motives may have been different, but in the end, they had both done the same thing: they had ransacked apartments in their occupants' absence.
Yoshino didn't look ashamed in the least, only annoyed. "I searched every corner of that place. Didn't find anything. Not his word processor, not the floppy disk." Yoshino bounced his knee with nervous energy. Then he noticed and placed a hand on the knee, flashing Ando a rueful smile.
Ando was recalling the photos he'd been shown of the scene of Asakawa's accident. He remembered the one that showed the interior of the car from the vantage point of the driver's side window. The thing he understood to be a video deck sat on the passenger's seat, wedged under the back of the seat where it had been pushed forward; on the floor on the passenger's side lay what looked like a laptop. The pair of black objects had made a deep impression on Ando. And now they gave him an idea. He turned his head, desperately trying to think, pretending to watch the crowd flowing out of the station like a human tidal wave.
Ando realized he knew where to find the report that could explain everything. No doubt Yoshino had searched Asakawa's apartment with great diligence, but the word processor and disk weren't there at all. Yoshino didn't know that Asakawa had brought them with him wherever he'd last been to, that they were in the car at the time of his accident.
Ando was now fairly confident he could get his hands on that disk, and he had no intention of sharing the information with Yoshino. He'd decide whether or not to tell the media only after he'd read Asakawa's report. Right now, all he knew was that this smallpox-like virus had been found in all seven of the corpses in question. They weren't ready yet to announce their findings in professional circles. In fact, they were only beginning to put together a research team consisting mainly of Shuwa and Yokodai people. If he went and let the media in on it at this stage, there was no telling what kind of panic they'd whip up. He had to proceed with utmost caution to make sure things didn't get out of hand.
Yoshino spent the rest of their meeting lobbing predictable questions at Ando. What were the results of the autopsy? What did he determine was the cause of death? Was any part of Yoshino's story suggestive in terms of the results of the autopsy? The reporter kept his face buried in his notebook as he went through his list.
Ando tried to answer each question as politely and as unobjectionably as he could. But all the while, his thoughts were lunging in another direction. He had to get his hands on that floppy disk right away. What did he need to do to make that happen?
6
The next day was Saturday. After finishing two autopsies, Ando took aside the young cop who was there as a witness and asked him what happened to cars that had been in accidents. If a car had been wrecked in an accident near the Oi exit of the Metropolitan Bayside Expressway, for instance, what was done with it?
"Well, first we'd inspect it." He was a trusty-looking young man with glasses. Ando had seen him several times before, but this was the first time he'd spoken to him.
"Then what?"
"Then we'd return it to the owner."
"What if it's a rental?"
"We'd return it to the rentacar agency, of course."
"Okay. There were three people aboard this car, a young couple and their daughter. They, ah, lived in a condo in Shinagawa, just the three of them. The wife and child died in the accident, and the husband is in critical condition. Now, what happens to the items that were in the car?"
"They'd be kept in temporary storage in the traffic division of the local precinct."
"For an accident that happened at the Oi off-ramp of the Metropolitan Expressway, what's the local precinct?"
"The exit?"
"Yeah, that's right. Near the exit."
"No, I mean, was it on the expressway or off it? They're different jurisdictions."
Ando thought back to the photos of the accident scene. He was certain it had happened on the expressway itself. He seemed to remember seeing the phrase "Tokyo Harbor Tunnel entrance" written in a file somewhere.
"It was definitely on the expressway."
Ando had never heard the name before. "Where's the headquarters?"
"Shintomi."
"Alright. So the items would be stored there temporarily. What next?"
"They'd contact the family and have someone come and get the items."
"Suppose, like I said, everybody in the family's dead."
"Even the siblings and parents of the man in the hospital?"
Ando knew nothing about Asakawa's parents and siblings. Judging from the man's age, there was a good chance that his parents were still alive. It raised the possibility that they were in possession of whatever was in the car. Asakawa and Ryuji had been classmates in high school. Since Ryuji's parents lived in Sagami Ohno, Asakawa's probably lived somewhere in that area, too. In any case, the first thing Ando should do was to look them up and contact them.
"I see. Thank you very much."
Ando released the young cop and straightaway set about locating Asakawa's parents.
He determined that they were both alive and living in the Kurihara section of the city of Zama, not far from Sagami Ohno. He placed a call and asked what had happened to the items from their son's car. Asakawa's father told him, in a strained voice, to call his eldest son, who lived in Kanda, in Tokyo. Kazuyuki, it turned out, was the youngest of three brothers: the oldest worked in the art book division of Shotoku, a major publisher, while the middle son was a junior high school Japanese teacher. Asakawa's father said that he had in fact received a call from the police asking him to come down and pick up some items they were keeping at the station, but instead of going to get them himself, he'd told them to contact his son in Kanda. Kanda wasn't too far from Shintomi, where the Metropolitan Expressway Traffic Patrol Unit had their headquarters, and Asakawa senior hadn't felt like lugging a word processor and a VCR home at his age-he was over seventy. So he'd arranged with the police for his son to pick up the items.
Ando's next move, then, was to contact Junichiro Asakawa, who lived with his wife in a Kanda condominium. When he finally managed to get in touch with him that evening, Ando came straight out and told him the situation, or most of it at least. He was afraid that if he aroused Junichiro's suspicions by slapping together a lie or a clumsy cover-up, he might never get his hands on the disk. On the other hand, he couldn't simply repeat the story Yoshino had told him. Ando didn't believe most of it himself, and Junichiro would surely think he was crazy. So he abridged things as he saw fit, ending by emphasizing that there was a possibility that Asakawa had left behind a document that might shed some light on what was happening. Speaking on behalf of the Medical Examiner's Office, he said he'd really like to get his hands on that document and wondered if he might be allowed to make a copy of it, please and thank you.
"I'm not sure there was anything like that in what I was given." Junichiro didn't sound entirely convinced. The way he spoke suggested that he hadn't yet taken a good look at the items.
"Is there a word processor?"
"Yes. But I think it's broken."
"Was there a floppy disk inside it?"
"To be honest, I haven't checked. I haven't even taken it out of the cardboard box they handed it to me in."
"Was there a video deck along with it?"
 
; "Yes, but I threw it away. Was that the wrong thing to do?"
Ando's breath caught in his throat. "You threw it away?"
"I can see why he'd be carrying around the word processor, because of his job, but why did he have a VCR with him?"
"Excuse me, but did you say you threw it away?"
"Yes. It was a total wreck. I'd arranged garbage pick-up for a TV the other day, so I had them take the VCR away at the same time. It was beyond repair. Anyway, I doubt Kazuyuki'll mind."
Ando had almost caught his two quarries, and now, at the last minute, one had eluded him. There'd been a good chance that the videotape that held the key to all this had been inside the VCR, and with luck he'd hoped to get his hands on both it and the floppy disk. He was kicking himself for not having contacted Junichiro sooner.
"Besides the VCR, there wouldn't happen to have been a videotape, would there?" Ando said a little prayer as he asked.
"I don't know. All I saw was the word processor, the VCR, and two black leather gym bags that probably belonged to Shizu and little Yoko. I haven't opened them."
Ando made sure Junichiro understood that he wanted to see them as soon as possible. "Would you mind if I paid you a visit?"
"That's fine," Junichiro agreed, surprisingly quickly.
"How about tomorrow?" Sunday.
"Let's see. I'm playing golf with one of my writers, but I should be back by seven."
"Well, then, seven it is." Ando made a note of the time, and underlined it several times.
At just after seven o'clock on Sunday evening, Ando called at Junichiro's condo in the Sarugaku section of Kanda. The neighborhood didn't feel very residential. Junichiro's building was surrounded by office blocks. The area was eerily quiet on Sunday evenings.
Ando rang the bell and heard a man's voice from behind the door ask, "Who is it?"
"This is Ando. I called yesterday."
The door opened immediately, and Ando was ushered inside. Junichiro was lounging around in a sweatsuit and his hair was wet; he must have just arrived home from golf and taken a shower. Somehow, from his voice on the phone, Ando had imagined him as a tall, nervous man, but in person Junichiro was heavyset and wore a genial expression. As Junichiro led the way into the apartment, Ando reflected that, of the three brothers, the eldest was an editor, the second a Japanese teacher, and the third a reporter for a major news organization. They'd all chosen fields that had them dealing with language, with writing, on a daily basis. Most likely, the eldest had been influential in this regard. Ando himself had been inspired to enter medicine by his older brother, who became a high school biology teacher.
Junichiro went to the closet in the hall and took out a cardboard box. The gym bags and the word processor had been stuffed into it.
"So. You'd like to take a look?" Junichiro sat down cross-legged on the floor and pushed the box in Ando's direction.
"Thanks, I would."
Ando first took out the word processor, jotting down the make and model. The machine's shell seemed to have been rather severely damaged in the crash; the top wouldn't open, and pressing the power button elicited no response. Standing it vertically on his knee, Ando noticed an eject button there on the side. It belonged to a slot, and peering into it he saw a blue floppy disk. He almost shouted for joy as he pressed the eject button. The machine produced a click that sounded to Ando like bingo! He took out the disk and held it on his palm for a moment, examining it back and front. The label hadn't been affixed, so there was no title to be seen. But Ando knew immediately that this was what he'd been searching for. It had sounded right popping out of the slot.
He wanted to read the disk as soon as he could, and he said to Junichiro, "I'd like to check out what's on here."
"I'm afraid this machine isn't compatible with mine." Junichiro wouldn't be able to use his word processor to open the files on the disk.
"In that case, would you mind if I borrowed the disk for two or three days?"
"It's alright with me, but…"
"I'll return it to you as soon as I'm done with it."
"What's on that disk, anyway?" Ando's excitement had evidently communicated itself. Junichiro suddenly seemed curious.
Ando shook his head. "I don't know, exactly."
"Well, I'd like it back as soon as possible." Now it appeared that Junichiro wanted to read it, too. Maybe his editorial instinct had been stirred.
Ando dropped the disk into his jacket pocket, and knew a sense of relief, but at the same time he was seized with a new desire. Those gym bags… He knew it was futile to hope, but he couldn't rule out the possibility that the videotape was in one of them.
"Would it be too much to ask if I could see what's in there?" He tried to choose his words carefully, somewhat embarrassed at the idea of going through a woman's belongings.
"I don't think there's anything in there," Junichiro laughed, but he handed over the bags. When he looked inside, Ando's faint hope of finding the tape was finally dashed. Mostly the bags contained clothes and disposable diapers. Not what he was looking for. Just as he'd feared, the tape had been inside the VCR when it was trashed.
Still, he'd gotten his hands on the floppy disk, and he had to count that a success. He could hardly stand still as he took his leave. He'd check around at work to see if anybody had a machine that could read the disk. He couldn't wait to see what was on it.
7
Ando poked his head into the Pathology Department office to see if Miyashita was in, but before he had a chance to say anything, Miyashita called out to him.
"Hey, just the man I wanted to see. Tell me what you think of this." Miyashita was holding a printout of something, and he beckoned to Ando with his other hand. Beside him stood Nemoto, an assistant in the biochem lab. Nemoto and Miyashita were built so alike that anybody who happened to see them together couldn't help but laugh. From their height and weight-five-three and easily over a hundred and seventy pounds- to the length of their legs, their girth, their faces, even their taste in clothes and their high voices, they were like two peas in a pod.
"Hey, I didn't know you had a twin." Ando uttered the same joke he always did as he approached them.
"Please, Dr Ando, don't lump me together with this guy," said Nemoto, grimacing. But it couldn't have been too awful to be told he took after his colleague, two years his senior. After all, Miyashita was liked both for his personality and his learning, and had been pegged as a future candidate for full professor.
"Everybody keeps telling us we look alike, Nemoto. I'm telling you, it's getting to be a pain in the butt. Why don't you go on a diet?" Miyashita elbowed the younger man's paunch.
"Well, if I go on a diet, you have to go on one, too."
"Then we'll be right back where we started!"
Then Miyashita offered Ando the printout he was holding, as if to put an end to the stale routine.
Ando spread out the printout he'd been given. He understood its contents at a glance. It showed the results of running a snippet of DNA through a sequencer.
All life on earth consists of one or more cells containing DNA (or, in some cases, RNA). The nuclei of these cells contain molecular compounds known as nucleic acids. There are two types of nucleic acids: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid). These play different roles. DNA is the compound in which genetic information is stored in the chromosomes: it takes the form of two long threads twisted about one another in a spiral, a shape known as the double helix. The sum total of a life form's genetic information is inscribed within that double structure. This genetic information is like a set of blueprints for the construction of specialized proteins; each gene is a blueprint. In other words, genes and DNA are not the same thing. A gene is a unit of information.
So what exactly is written on these blueprints? The letters that make up the inscriptions are four chemical compounds known as bases: adenine (A), guanine (G), cytosine (C), and thymine (T) or in the case of RNA, uracil (U). These four bases work in sets of three ca
lled codons, which are translated into amino acids. For example: the codon AAC makes asparagine, the codon GCA makes alanine, etc.
Proteins are conglomerations of hundreds of these amino acid molecules, of which there are twenty types. This means that the blueprint for one protein must contain an array of bases equal in number to the number of amino acid molecules times three.
The blueprint called the gene can be thought of, then, as basically a long line of letters, looking something like this: TCTCTATACCAGTTG-GAAAATTAT… Translated, this signifies a series of amino acids that runs: TCT (serine, or Ser), CTA (leusine, or Leu), TAC (tyrosine, Tyr), CAG (glutamine, Gln), TTG (leusine, Leu), GAA (glutamic acid, Glu), AAT (asparagine, Asn), TAT (tyrosine, Tyr), etc. etc.
Ando glanced again at the base codes covering the printout, the four letters A, T, G, and C lined up seemingly at random across the page. Segments of three rows had been highlighted so as to stand out from the rest.
"What's this?"
Miyashita winked at Nemoto, as if to say, you tell him.
"This is an analysis of a segment of DNA taken from the virus found in Ryuji Takayama's blood."
"Okay… so what's this?"
"We found a rather strange sequence of bases, something we've only seen in Takayama's virus."
"And that's what's highlighted here?"
"That is correct."
Ando took a closer look at the first highlighted series of letters.
ATGGAAGAAGAATATCGTTATATTCCTC CTCCTCAACAACAA
He looked at the next highlighted portion, and compared it with the first. He realized it was exactly the same sequence. In a group of not even a thousand bases, the exact same sequence occurred twice.