“They’re waiting for us to drift past,” the President said. “They’re waiting for a shot past the sail.”
“They can’t just blow us away,” Senator 2 said plaintively. “We might be sundogs. Mech defectors.”
“Stay on that drone, Rep Three!” the President ordered.
Smiling sunnily, Rep 3 removed his earphones and turned his goggled face toward the others. “What’s that, Mr. President?”
“I said stay on those frequencies, God damn it!” the President shouted.
“Oh, that,” said Rep 3. He scratched within his spacesuit collar, holding the doubled phones to one ear. “I was doing that already. And—oh, yeah.” He paused, while the crew held their breath. The goggles blocked his eyesight, but he reached out unerringly and touched switches on the board before him. The control room was filled with a high-pitched staccato whine.
“Cut it in on visuals,” Rep 3 explained, tapping the keyboard. The asteroid vanished, replaced on the screen by column after column of alphanumeric gibberish:
TCGAGGCTATCGTAGCTAAAGCTCTCCCGATCGATATCGTCTCGAGATCGATCGATGCTTAGCTAGCTAGTTGTCGATCGTAGGGCTCGAGCTA…
“Shaper genetics code,” the Speaker said. “I told you so.”
“Their last signal before we take them out,” the President said boldly. “I’m declaring martial law as of this moment. I want everyone in battle gear—except you, State. Hop to it.”
The crew scrambled, their nerves unkinking in a burst of action. Lindsay watched them go, thinking of the stream of data to the Ring Council that had betrayed the outpost.
The Shapers might have thrown their lives away with that last cry. But the enemy, at least, had someone who would know their deaths, and mourn.
Chapter 4
ESAIRS XII: 21-12-’16
They called the asteroid ESAIRS 89-XII, the only name it had ever had, drawn from an ancient catalog. ESAIRS XII was a potato-shaped lump of slag, half a kilometer long.
The Red Consensus hovered over its bulging equator, anchored by a guy line.
Lindsay pulled himself one-handed down the line. Glimpsed through his faceplate, the asteroid was dark, with long coal-powder streaks of carbonaceous ore. Cold gray and white blurs marked the charred impact points of primeval collisions. The biggest craters were eighty meters across, huge lava sumps of cracked slag and splattered glass.
Lindsay landed. The expanse beneath his boots was like pumice, a static off-white surf of petrified bubbles. He could see up and down the asteroid’s length, but its width curved out of sight behind a horizon a dozen steps away.
He bent and pulled himself along, gripping knobs and cavities with the rough fingers of his gauntlets. The right hand was bad. The tough interior fabric of the glove felt soft as cotton to his nerve-burned fingers.
He crawled, legs bobbing aimlessly, over the rim of an oblong crater, the scarred gouge of some glancing collision. It was five times as deep as he was tall, and its floor was a long gas-smoothed blister of greenish basalt. A long bloated ridge of molten rock had almost lifted free into space but then frozen, preserving every last ripple and warp…
It slid aside. The rock ridge shriveled, crumpling like silk, its warps and bumps revealed as shaded camouflage on a plastic film.
A cavern yawned below. It was a tunnel, curving just below the surface.
Lindsay picked his way cautiously down the slope and flung himself into the tunnel. He braced himself against its walls. Stretching overhead, he pushed against the tunnel’s ceiling to plant his feet.
Sunlight dawned over the tiny horizon and fell into the tunnel.
It was precisely circular and inhumanly smooth. Six tracks of thin metallic ribbon had been epoxied into place, running lengthwise along the corridor. In raw sunlight the tracks had the gleam of copper.
The tunnel apparently girdled the asteroid. It curved rapidly, like the horizon. Before him, almost hidden by the tunnel’s curvature, he glimpsed the dim sheen of brown plastic. Jumping and shoving along the walls, he bounced toward it in free-fall.
It was a plastic film with an inert fabric airlock. Lindsay pulled the zippered airlock tag and stepped in. He zipped it up behind him, undid a second zipper in the lock’s inner wall, and climbed through.
He was in a cavernous black and ocher balloon. It had been blown up within the tunnel, filling it tightly.
A figure in a plastic decontamination suit floated upside down below the ceiling, a bright green silhouette against hand-sprayed black arabesques on an ocher background.
Lindsay’s suit had gone flat, indicating air pressure. He took his helmet off and inhaled cautiously. It was an oxy-nitrogen mix, standard air.
Lindsay held his right arm across his chest with deliberate awkwardness. “I, uh, have a prepared statement to read. If you have no objection.”
“Please proceed.” The woman’s voice was thin, half muffled. He glimpsed her face behind the plate: cold eyes, tawny skin, dark hair held in a green net.
Lindsay read the words slowly, without inflection. “Greetings from the Fortuna Miners’ Democracy. We are an independent nation, operating under the rule of law, firmly predicated on a basis of individual civil rights. As emigrants into our national territory, new members of the body politic are subject to a brief naturalization process before assuming full citizenship. We regret any inconvenience caused by the imposition of a new political order.
“It is our policy that ideological differences be settled by a process of negotiation. To that end, we have deputized our Secretary of State to establish preliminary terms, subject to ratification by the Senate. It is the wish of the Fortuna Miners’ Democracy, as expressed in House Joint Resolution Sixteen, Sixty-Seventh Session, that you begin negotiation without delay under the Secretary’s aegis, so that the interim period may be as brief and as secure as possible.
“We extend to our future citizens the hand of friendship and warm congratulations.
“Signed, President.”
Lindsay looked up.
“You’ll want a copy of this,” he said, extending it.
The Shaper woman floated closer. Lindsay saw that she was beautiful. It meant very little. Beauty was cheap among Shapers.
She took the document. Lindsay pulled more from a hip valise, with his left hand. “These are my credentials.” He handed them over: a wad of recycled printout gaudy with Fortuna foil seals.
The woman said, “My name is Nora Mavrides. The rest of the Family has asked me to convey to you our impression of the situation. We feel that we can convince you that the actions you’ve taken are rash, and that you can profit by turning your attention elsewhere. We ask for nothing but the time to convince you. We have even shut down our main gun.”
Lindsay nodded. “That’s nice. Very good. Should impress the government very much. I’d like to see this gun.”
“We are inside it,” said Nora Mavrides.
ABOARD THE RED CONSENSUS: 22-12-’16
Lindsay said, “I played dumb. But I don’t think she bought it.” He was addressing a joint session of the House and Senate, with the Speaker of the House presiding. The President was in the audience. The Supreme Court Justices were manning the gun and control room, listening in on an intercom.
The President shook his head. “She believed it. Shapers always think we’re stupid. Hell, to Shapers we are stupid.”
Lindsay said, “We’re tethered just past the outlet of their launch ring. It’s a long circular tunnel, a ring around the rock’s center of gravity, cored just under the surface. It has magnetic strips for acceleration and some kind of magnetic launch bucket.”
“I heard of those,” said Justice 3, over the intercom. He was their regular gunner, a former miner, close to a century old. “It starts with jus
t a little boost, get that bucket up, magnetized. Rides on a magnetic cushion, then you accelerate it, let it zip around a while, then brake it just behind the outlet. The bucket slows but the cargo shoots out at klicks per second.”
“Klicks per second?” said the Speaker of the House. “That could blow us away.”
“No,” said the President. “They’d have to use a lot of power for a launch. This close, we’d pick up the magnetics.”
“They won’t let us in,” Lindsay said. “Their Family lives clean. No microbes, or only tailored ones. And we have Zaibatsu stuff in every pore. They’re going to offer us loot to go away.”
“That’s not our assignment,” the Speaker said.
“We can’t judge their loot unless we see their quarters,” Rep 1 said. The young Shaper renegade brushed at her hair with enameled fingertips. She had been dressing well lately.
“We can dig our way in with the excavator,” the President said. “We’ll use the sonar readings we made. We got a good idea of the closest tunnels to the surface. We could core in in five-ten minutes, while State negotiates.” He hesitated. “They might kill us for it.”
The Speaker’s voice held cold certainty. “We’re dead anyway, if they keep holding us off at arm’s length. Our gun is short-range. That launch ring can plaster us hours after we leave.”
“They didn’t do it before,” said Rep 1.
“Now they know who we are.”
“There’s only one thing for it,” the President said. “Put it to a vote.”
ESAIRS XII: 23-12-’16
“We’re a miners’ democracy after all,” Lindsay told Nora Mavrides. “According to Fortuna ideology, we had a perfect right to drill. If you’d mapped your tunnel network for us, this wouldn’t have happened.”
“You risked everything,” Nora Mavrides said.
“You have to admit there were benefits,” Lindsay said. “Now that your network has been, as you say, ‘contaminated,’ we can at least meet face to face, without spacesuits.”
“It was reckless, Secretary.”
Lindsay touched his chest left-handed. “Look at it from our perspective, Dr. Mavrides. The FMD will not wait indefinitely to take possession of its own property. I think we’ve been quite reasonable.
“You keep assuming that we mean to leave. We are settlers, not brigands. We won’t be turned aside by nebulous promises and anti-Mechanist propaganda. We are miners.”
“Pirates. Mech hirelings.”
Lindsay shrugged one-sidedly.
“Your arm,” she said. “Is it really hurt? Or do you pretend it, to make me think you’re harmless?”
Lindsay said nothing.
“I take your point,” she said. “There’s no true negotiation without trust. Somewhere we have common ground. Let’s find it.”
Lindsay straightened his arm. “All right, Nora. If this is between just the two of us, role-playing aside, let’s hear you. I can bear any level of frankness you’re willing to advance.”
“Tell me your name, then.”
“It won’t mean anything to you.” She was silent. “It’s Abelard,” he said. “Call me Abelard.”
“What’s your gene-line, Abelard?”
“I’m no Shaper.”
“You’re lying, Abelard. You move like one of us. The arm business camouflaged it, but your clumsiness is too deliberate. How old are you? A hundred? Less? How long have you been sundogging it?”
“Does that matter?” Lindsay said.
“You can go back. Believe me, it’s different now. The Council needs you. I’ll sponsor you. Join us, Abelard. We’re your people. Not these germy renegades.”
Lindsay reached out. Nora drew back, the long laces of her sleeve ties jerking in free-fall.
She was beautiful. The Mavrides clan was a gene-line he hadn’t seen before. Wide, hazel eyes, with a trace of epicanthic fold, more Amerindian than oriental. High cheekbones, straight aquiline nose. Feathery black eyebrows, and a wealth of shimmering black hair, which in free-fall formed a bushy mass of curled tendrils. Nora’s hair was confined in a loose free-fall headdress, a jade-green plastic turban with a crimson drawstring at the back and a serrated fringe of forest green above her bangs. Her coppery skin was clear and inhumanly smooth, with a dusting of rouge.
There were six of them. They had a close family resemblance, but they were not identical clones. The six were that tiny percentage of the Mavrides gene-line which had been drafted: Kleo, Paolo, Fazil, Ian, Agnes, and Nora Mavrides. Kleo was their leader. She was forty. Nora was twenty-eight. The rest were all seventeen years old.
Lindsay had seen them. He’d pitied them. The Ring Council did not waste investment. A seventeen-year-old genius was more than sufficient for the assignment, and they were cheap. They had looked him over with cold hazel eyes, with the alert and revolted stare that a man reserves for vermin. They longed to kill him, with a hunger tempered only by disgust.
It was too late for that now. They should have killed him far away, when they could have stayed clean. Now he was too close. His skin, his breath, his teeth, even his blood seethed with corruption.
“We have no antiseptics,” Nora said. “We never thought we’d need them. It won’t be pleasant for us, Abelard. Boils, weals, rashes. Dysentery. There’s no help for it. Even if you left tomorrow, the air from your ship…it was crawling.” She spread her hands. Her blouse had scarlet drawstrings at the wrists, with puffed slashed sleeves showing the smooth skin of her forearms. The blouse was a wraparound garment, tied with short strings at each hip and belted at the waist. She’d sewn it herself, embroidering the lapels in pink-and-white gridwork. Below it she wore shorts cinched at the knee and lace-up crimson sandals.
“I’m sorry,” Lindsay said. “But it’s better than dying. The Shapers are burned, Nora. They’re finished. I have no love for the Mechs, believe me.” For the first time, he gestured with his right arm. “Let me tell you something I’ll deny if you repeat. The Mechs wouldn’t exist if it weren’t for you. Their Union of Cartels is a sham. It’s only united by fear and hatred of the Reshaped. When they’ve destroyed the Ring Council, as they must, the Mechs themselves will fly to pieces.
“Please, Nora. See it my way for a moment, for the sake of argument. I know you’re committed, I know you’re loyal to your gene-line, your people back home. But your death won’t save them. They’re burned, doomed. It’s just you and us now. Eighteen people. I’ve lived with these Fortunans. We know what they are. They’re scum, pirates, marauders. Failures. Victims, Nora. They live in the gap between what’s right and what’s possible.
“But if you go along, they won’t kill you. It’s your chance, a chance for the six here…After they’ve shut you down, they’ll go back to the cartels. If you surrender, they’ll take you along. You’re all young. Disguise your pasts, and in a century you could be running those cartels. Mech, Shaper, those are only labels. The point is that we live.”
“You’re tools,” the woman said. “Victims, yes, I’ll accept that. We’re victims ourselves. But victims in a better cause than yours. We came here naked, Abelard. We were shipped here in a one-way drogue, and the only reason we weren’t blown away in flight is because the Council launches fifty decoys for every real mission. It costs the cartels more to kill us than we’re worth.
“That’s why they hired you. The rich Mechs, the ones in power, have turned you on us. And we were surviving. We made this base from nothing with our hands, brains, and wetware. It was you who came to kill us.”
“But we’re here now,” Lindsay said. “What’s past can’t be helped. I’m begging you to let me live, and you give me ideology. Please, Nora, bend a little. Don’t kill us all.”
“I want to live,” she said. “It’s you who should join us here. Your lot won’t be of much use, but we could tolerate you. You’ll never be true Shapers, but there’s room for the unplanned under our a
egis. In one way or another, we outflank every move the cartels make against us.”
“You’re under siege,” Lindsay said.
“We break out. Haven’t you heard? The Concatenation will declare for us. We have one circumlunar already: the Mare Serenitatis Circumlunar Corporate Republic.”
Even here Constantine’s shadow had touched him. “You call that a triumph?” he said. “Those decadent little worlds? Those broken-down relics?”
“We will rebuild them,” she said with chilling confidence. “We own their youth.”
ABOARD THE RED CONSENSUS: 1-1-’17
“Welcome aboard, Dr. Mavrides,” the President said. He extended his hand. Nora shook it without hesitation; her skin was protected under the thin plastic of her spacesuit.
“A fine beginning for the new year,” Lindsay said. They were on the control deck of the Red Consensus. Lindsay realized how much he’d missed the familiar pop-blip-and-squeak of the instruments. The sound settled into him, releasing tension he hadn’t known he had.
The negotiations were twelve days old. He’d forgotten how bad the pirates looked, how consummately grubby. They had clogged pores, hair rank with grease, teeth rimmed with plaque. To a Shaper’s eyes they looked like wild animals.
“This is our third agreement,” the President said formally. “First the Open Channels Act, then the Technological Assessment and Trade Consensus, and now a real breakthrough in social justice policy, the Integration Act. Welcome to the Red Consensus, doctor. We hope you’ll regard every angstrom of the craft as part of your national heritage.”
The President pinned the printout treaty to a bulkhead and signed it with a flourish. Lindsay printed the state seal with his left hand. The flimsy paper ripped a little.
“We’re all nationals here,” the President said. “Let’s relax a little. Get to, uh, know each other.” He pulled a gunmetal inhaler and sniffed at it ostentatiously.