Larger Font   Reset Font Size   Smaller Font  

Spiral, Page 8

Paul Mceuen


  Once inside, Liam pulled a bottle of Cooley whiskey and two tumblers out of the bag. He poured two fingers into each tumbler.

  Jake said, “To what do I owe the visit?” Though he knew.

  “Thought you might want a drink. Given all that’s happening today.”

  “All” being Gulf War II.

  Jake had tried to avoid the TV, the images of missile assaults on Baghdad, banners in blue and white along the bottom, but Liam flipped it on. “Shock and awe,” Liam said. “Wars have taglines now.” Jake barely heard him. The visuals were enough to set the triggers snapping inside him, the trip wires of an ex-soldier. The itchy feeling, dread and adrenaline. The sense that he should be there, a part of it, good or bad. The ground incursion had started up a few hours before, a massive wall of steel and ordnance grinding forward out of Kuwait. It was going even easier than the first round, thirteen years before. No columns of Iraqi soldiers to plow under. They had learned. They stayed out of the way of the grinding monstrous machine. The real fight would come later, though no one knew that then.

  Liam took a drink. “May it be short, and then may it be over.”

  JAKE CLOSED THE CABINET DOOR, LETTING THE MEMORY GO. He looked around the lab, trying to focus on his task. Anything out of the ordinary.

  A lab notebook lay on the bench, facedown. He glanced at Becraft.

  “Can I?” Jake asked. Becraft nodded.

  Jake picked up the notebook by the edges, turned it over. He touched a finger to the mottled red cover. Liam had written his name on it, along with the start date, March 23. No ending date. Most everyone used computers for lab notebooks these days, but Liam stuck to paper and pen.

  Jake opened it and scanned the entries. Most of it was standard stuff—descriptions of experiments, names of data files, and lists of protocols. But there were other items, too:

  Mountain chickadees can lose 10% of their bodyweight overnight in winter and face certain death if they don’t get food every 24 hrs.

  Liam’s notebooks were famous among his colleagues and students. Everyone liked to sneak a peek at them. He kept everything in them, seeing no clear separation between a genetic sequence and an aphorism.

  Jake flipped through the pages, coming across a series of comical drawings. A bumblebee wearing glasses and smoking a cigar. A spider blowing bubbles. Liam had rendered them in exquisite detail and with considerable skill. Jake flipped forward, the dates in the notebook approaching the present. He stopped on October 25, yesterday. The last entry was a series of numbers, column after column, rendered in Liam’s careful handwriting.

  “Anything?” Becraft asked.

  “Not so far.”

  “Can you take a look at this?”

  The investigator had Liam’s Internet history up on his laptop.

  http://www.msnbc.msn.com/

  http://www.google.com/

  http://www.msnbc.msn.com/

  http://gene.genetics.uga.edu/

  http://www.msnbc.msn.com/

  http://www.letterboxing.org/

  http://www.amazon.com/

  http://www.rawstory.com/

  http://www.nytimes.com/

  http://www.msnbc.msn.com/

  Jake scanned through the list: MSNBC. Amazon. All mundane entries. Apparently, before you leap off a bridge you read the news and go shopping for a book.

  Bullshit.

  “A couple of these stand out to me,” said the investigator. He clicked on http://gene.genetics.uga.edu. The page popped up.

  “It’s a fungal genetic database,” Jake said. “See? Click on an organism, choose a chromosome, and up comes the genetic sequence.” Jake hit a few keys, and an almost endless string of genetic letters appeared.

  GACTAGCCATTTAACGTACCATTACCTA…

  “So this is a website he’d go to as part of his work?”

  “All the time. He was genetically engineering fungi. Shuffling genes in and out to get what he wanted. That’s what the gardens are about.”

  They kept at it, but all of the other websites appeared equally benign. No sites about suicide. Nothing about cancer, or depression, or anything else indicating that Liam was sick or distraught in any way. No sites about God or death or love. Just the normal detritus of the day.

  Jake felt trapped, wanted to crawl out of his skin, see it from a different angle. He just couldn’t make it work. He simply could not reconcile the man he knew with the action he’d taken. No one commits suicide out of the blue like that, not without hinting at it first, not without showing some kind of sign. There was something he wasn’t seeing, but what?

  Jake looked again around the room. The neat stacks of papers. The notebook on the lab table. The fungi in the gardens of decay. It was Liam’s world. Nothing different than any other day.

  He stood over the gardens, stared down at the even rows of squares. He couldn’t escape a small itch, a sense that something was awry.

  When it hit him, he couldn’t believe he hadn’t seen it before.

  Jake turned to Becraft. “Did you do something with the Crawlers?”

  “Crawlers?”

  “The ones he used here in the garden. There should be ten or twenty of them. Maybe a few more over there on the table.”

  “What are you talking about?”

  “MicroCrawlers. They’re little robots—they look sort of like spiders. The devices allowed Liam to tend to thousands of different fungal samples, all by himself. They were like his graduate students.”

  “How big?”

  “Each is about the size of a fingernail. Your men didn’t take them?”

  “No.”

  “Maybe when they came earlier? To secure the room?”

  “No. No one else has been inside. Nothing was touched.”

  “You’re sure.”

  “Yes.”

  “Well, they’re gone. Someone must have taken them.”

  “Why would someone take them? Who else had key access to this room?”

  “Just me, Liam, and a couple of my graduate students. I don’t get it. If someone wanted Crawlers, they wouldn’t come here first. They would go to my lab. We’ve got hundreds of them.”

  “Could some of yours be missing, too?”

  Jake thought it through. “I need to talk to Dave and Joe.”

  8

  DUFFIELD HALL LOOMED OVER THE ENGINEERING QUAD, A blocky monolith of glass and steel glowing in the darkness. Inside was the Cornell Nanofabrication Facility, or the CNF, as it was known to three decades of students. Jake checked his watch: ten-fifteen p.m. More than twelve hours had passed since they’d discovered Liam’s body.

  Jake entered Duffield Hall through double doors on the north end of the building. This led into a huge atrium that extended nearly a hundred yards. On a typical day, sunlight poured though the translucent skylights in the high ceiling above, and students and faculty would be everywhere, chatting, ordering drinks at the coffee stand, and lounging in chairs along the walls. Even at this hour, a handful of students and faculty would typically be about, but tonight the space was eerily quiet, as if life itself had been drained out of the campus with Liam’s death.

  To the right was a series of windows opening into the CNF labs. Joe and Dave were inside, looking for any sign of the missing Crawlers and double-checking that their own stocks were untouched. A careful check of Liam’s records, plus information Maggie had given the police about a Crawler funeral, had put the total number missing at thirteen. Jake and his students had been at it for more than six hours, searching for them everywhere, brainstorming about where they could be or why someone would have taken them. Maybe they’d been stolen by undergraduates as a prank, or Liam had locked them away for safekeeping somewhere? So far, they were in the dark.

  Jake’s phone went off. He checked the area code—California—and let it go. His phone had not stopped ringing—colleagues, reporters, friends—everyone wanting to know what had really happened. Jake had called back only a select few people. He had called his DARPA grant manager,
a Stanford professor on loan to DARPA in Arlington, Virginia, and told him about the missing Crawlers. Since DARPA paid the bills, Jake thought they deserved to know. He’d also tried to call Maggie Connor—to offer his condolences and ask how Dylan was holding up—but the phone had been constantly busy.

  Jake stared into the glass that separated him from the rarefied environment inside the CNF. This is where Dave and Joe made the Crawlers, carving them out of silicon wafers like Michelangelo finding the David inside the stone. The room before him was filled with GCA projection steppers, wafer coaters, and an old EV620 contact mask aligner, all part of the assembly line of the micro-world. This entire section of the CNF was standard computer-chip technology—furnaces for growing oxides, acid baths for etching, and evaporators for depositing metal films. Enough sheer miniaturizing power to write the Encyclopaedia Britannica on the head of a pin.

  A young woman entered, dressed in a light blue jumpsuit, blue booties, and a white headcovering. She looked a little like Beth, his ex-wife. They’d married young, then grown apart after he had come back from the war. She lived in Phoenix now, was remarried, with a kid, a little girl named Olivia. Once a year they talked on the phone. There wasn’t much to say. Beth had a new life. She was doing okay.

  Jake watched the woman work, movements deliberate as she dipped a silicon wafer into a beaker, holding it carefully with specialized tweezers. She clicked the button on a stopwatch, swishing the wafer in the liquid. After a time, she lifted it out and dipped it into a water bath. Jake recognized the procedure, the ritual. The removal of every speck of dust and dirt, leaving behind nothing but the pure silicon crystal underneath, every atom locked in its place relative to its neighbors. The elimination of everything that did not belong, so she could begin her work on a perfect canvas.

  She glanced up, saw him watching. He smiled politely, turned away.

  Liam’s death was bringing back the black empties. It was just like it had been with Beth—he couldn’t fully connect with her. Jake felt detached, slippery, as though his insides and outsides were disconnected.

  He returned his thoughts to Liam. Though Liam was a biologist, he loved the wonderful precision of all this technology, the miniature landscapes of almost impossibly intricate detail that were created. Liam had been there in the beginning, at the birth of the first information revolution. He was friends with all of the big players: Alan Turing, von Neumann at Princeton, Weiner at MIT. The ideas were there by the fifties—the vision of machines executing algorithmic programs stored on some kind of linear tape. It was increasingly clear that life worked that way, with DNA as the tape, and cells as the machines that executed the programs. It was also clear that electronics could be made to work that way, with magnetic bits or packets of charge as the data and computer chips as the processors.

  Shockley, Kilby, Moore—they took up the challenge. Liam knew all of them, right up to Bill Gates and the Google guys. He’d said he had a front-row seat for the information revolution and he wasn’t going to waste it. He’d studied the growth of the semiconductor industry like he studied fungi, following each step in the evolution of this new technology, and watching, in turn, how the world adapted to it.

  And he’d loved the Crawlers. While the military saw the Crawlers as potential spies, Liam saw them as soldiers in a new revolution. Liam believed that a second wave was coming—one even bigger than the information revolution. When the technologies of the information age were applied to biology, life would become an engineering discipline. Using tools such as microfluidic labs-on-a-chip, PCR machines, and assemblers such as the MicroCrawlers, you’d be able to make living cells the way you made computer chips, process DNA like so many ones and zeroes. He was incredibly excited. He thought that in five years he’d be making fungi from scratch. Design their genetic sequence on the computer, push a few buttons, and there they would be. A genome as easy to write as a string of computer code. A new fungus as simple to construct as an integrated circuit. He maintained that the Crawlers would be the foot soldiers in the revolution.

  Jake still couldn’t believe that Liam wouldn’t be there to see it happen. Wouldn’t be there when someone managed to boot up the first artificial cell. When kids started to post their favorite genomes on their MySpace pages. When the cell nucleus replaced the computer chip as the symbol of technological sophistication.

  When Dylan built his first bacterium.

  Liam thought the technologies of synthetic biology would be a tsunami, one that would make the electronics revolution seem like ripples in a pond. Jake could barely imagine it. What would it be like when companies manufactured creatures instead of products? When disaffected kids used the tools of the synthetic biology revolution to hack into life instead of into computers?

  Jake felt himself sagging. He tried to shake off the exhaustion. All he knew for sure was that the new revolution would be messy. There were no simple equations for something like life. It was a completely different kind of problem. A random mutation and the smallest player could suddenly take down the largest, multiplying again and again, growing exponentially. A virus jumps from a monkey to a human and you have the AIDS epidemic. Ebola escapes the jungles of Africa and a hundred million could die. A dominant player like Homo sapiens could be laid low in an instant. It was madness, a wild, crazy war with billions of warriors, millions of different sides. No one could predict the outcome, not even Liam Connor.

  Joe emerged from the CNF, looking beat.

  “And?” Jake asked.

  “We checked everywhere. We opened every storage bin. Every wafer cassette. Looked in every sample box.”

  “And you found?”

  “Not a Crawler out of place.”

  JAKE WAS JUST ABOUT TO DISMISS ANY SINISTER SIGNIFICANCE to the missing Crawlers. No matter how he turned it over in his head, no matter what angle he looked at it from, he couldn’t see how the missing Crawlers could be connected to Liam’s death. And Jake had a rule: never blame conspiracies when mischief or happenstance would suffice.

  But then came two new pieces of information.

  The first came from Vlad Glazman, Jake’s friend and scientific colleague, a fifty-two-year-old Russian émigré and tenured professor of computer science. Vlad had asked Jake to stop by his lab. “For a drink,” he said. “In honor of our lost friend.” He wouldn’t say more, but Jake knew there was more. Vlad knew Liam as well as Jake did, maybe better.

  Jake arrived at Vlad’s lab just after midnight to find the Russian working his way through a bottle of Gorilka Nemiroff—“a nice Ukrainian vodka,” Vlad said. He was a squat man, with a square head and broad shoulders, as if he’d been compressed by a vise. His hair was dark, like his eyes, and his lips were surprisingly full, almost sensual. He was married to a woman he’d met at a conference in Europe, as blond and tall as he was dark and squat. They were having problems.

  Vlad poured Jake a drink and said, “You think Connor was sick?”

  “I don’t know what to think.”

  Vlad grunted. “He was not sick.”

  Jake took a swallow and found the vodka pleasantly harsh, the burn on the back of the throat a welcome fire. He let his gaze walk around the room. Vlad’s lab was a mashup of science, with UNIX boxes and Cat5 cables next to PCR machines and rows of thumb-activated pipettes. Nearly every bit of available counter space in Vlad’s lab was covered by stacks of papers. He had cleared them off a spot, carefully allocating the displaced papers to other piles.

  Vlad lifted his glass, took a drink. “You know what I think?” Vlad said.

  “Tell me.”

  “He knew secrets.”

  “What kind?”

  “Secrets they didn’t want him to tell.”

  “ ‘They’?”

  “They.”

  “Vlad the Paranoid,” Jake said. Which was true. Vlad saw darkness everywhere. In Moscow, he’d spent his nights building CPUs out of salvaged parts while toiling away during the day as a low-level technical staffer for Directorate T�
��Scientific and Technical—a part of the First Chief Directorate of the KGB. Vlad’s status as a Jew kept him from achieving a formal position of any significance, but he got out, and the West had no such restrictions. Since coming to Cornell, he had become a major player in asynchronous information processing, writing code that kept different computer processors happily talking to one another. Five years ago, Vlad had switched fields to synthetic biology, drawn by the promise of programming in the code of life. He plied his trade with money leaking across the dark boundary of classified research. He had contacts throughout the military-funding universe: at ONR, AFOSR, DARPA, you name it. He had never lost the sense from his days in the Soviet Union that someone was looking over his shoulder.

  Jake thumbed a paper on a pile next to him, something on micro-RNA gene regulation. The piles looked haphazard, but Vlad knew exactly what was in every one of them. Jake had seen it many times: He’d reach into a pile, pull out the exact article from Science or the Proceedings of the National Academy of Sciences that they’d been discussing. “The fossil record,” Vlad would say.

  Jake said, “You’re saying someone killed him? But the video showed him jump.”

  “I’m saying nothing. I am letting vodka talk.”

  “Let it talk more.”

  Vlad took another sip. “I had conversation with friend at DTRA.”

  “Ditra?”

  “Defense Threat Reduction Agency. The go-to agency for anti-WMD.” Vlad closed one eye, thinking hard. “Located in Virginia—Fort Belvoir. Couple thousand employees. Budget two billion a year.”

  “And who is this friend?”

  Vlad waved him off.

  “Okay. So you had a conversation. And?”

  “He wanted to know what happened.”

  “To Liam? What did you tell him?”

  “I told him what I know. Which is nothing.”

  “And why was he asking?”

  “You liked Liam, right?”

  “You’re kidding? I would’ve killed for him. Why?”

  “He was smart, Liam Connor. Complex. Playing games on many levels.”