Larger Font   Reset Font Size   Smaller Font  

Spiral

Paul Mceuen


  After his release, Kitano became part of a network of Unit 731 veterans who took up positions of authority within the Japanese medical and pharmaceutical industries. He was a cofounder of Green Cross, a Japanese pharmaceutical company that rose to prominence after the end of World War II. Green Cross ran one of the larger blood banks in Japan, and Kitano profited handsomely. Kitano abruptly left Green Cross in the early 1980s, selling his stake for in excess of two hundred million dollars. Soon after, Green Cross became enmeshed in controversy for knowingly selling HIVtainted blood. Approximately a thousand Japanese contracted the disease and eventually died.

  Kitano took his money and moved to the United States. He bankrolled various biological start-ups, both in La Jolla and north, in Silicon Valley. A few of these hit it big, and by the mid-1990s Kitano’s net worth was approaching the five-billion mark. Through the 1990s, Kitano amassed even more with investments in a number of health-related dot-coms, clearly seeing both the promise and the hype of the Internet. In 2000, he divested from Silicon Valley just before the bust. He was flush with cash, looking for the next wave.

  After the events of September 11, he saw it. The Kitano Group, his investment firm, poured money into military-related start-ups, correctly predicting that an administration unwilling by temperament to expand a federal bureaucracy would be dumping money into the private sector. They invested in companies that provided the military with everything from data-mining services to personnel. Kitano himself had personally overseen the group’s investments in biotech ventures, particularly those aimed at bioterrorism countermeasures. They had large positions in most of the major players, from Genesys to DNA Biosystems. Kitano had also begun acquiring biotechnology companies in Japan, Korea, and China, constructing a pan-Asian network that would be the cornerstone of economic progress in the region as synthetic biology replaced silicon microelectronics as the dominant growth technology.

  Kitano was not just involved in business ventures. He had also carefully cultivated relationships with a number of prominent American foreign-policy hawks, Lawrence Dunne among them. Kitano funded a trio of neoconservative, pro-Japanese think tanks, including one where Dunne had camped out between posts in Washington and stints teaching. They were a formidable team, working in concert to build a bulwark against the rising power of the Chinese. Their greatest achievement being, of course, the election of the current president of the United States, a pro-America, anti-China crusader.

  Kitano had also helped Dunne take a modest nest egg and turn it into a not-so-modest nest egg. He’d also introduced Dunne to some of the other pleasures to be had by those of great wealth and power. Most of Dunne’s colleagues did their best to keep Kitano at arm’s length. Stories still surrounded him, rumors about his role in the Japanese war effort in World War II. This history drew Dunne like a moth. For almost two decades, the two men forged a professional and personal relationship based on their mutual distrust of China and their love of expensive scotch and women.

  Kitano had it all—an enormous economic empire, and the ear of the most powerful government on the planet.

  Then the old man fucked up.

  KITANO WAS A STATUE, COMPLETELY MOTIONLESS AS HE SAT dead in the center in his cell.

  “Does he know he’s being watched?” Dunne asked.

  “He’s never shown signs. Never looks up. Nothing.” Robbins shook his head. “I don’t get it. His routine was normal this morning.”

  “Show me.”

  Robbins hit a few keys and an image on a second screen appeared, the time stamp showing seven-twenty-two a.m. Kitano was doing some kind of knee bends. “Every morning he performs a half-hour of calisthenics. After that he reads until the gates open and he’s allowed to visit the common room. There he watches television. Give me a second. We’ve got a camera in there, too. I’ll bring up the video from this morning.”

  The image shifted. The time stamp said eight-oh-four a.m. Kitano sat alone in a chair, watching television, rapt. The rest of the prisoners sat as far away as possible, clearly avoiding him.

  Dunne knew why. Soon after arriving at USP Hazelton, a prisoner stole Kitano’s lunch, thinking him to be a powerless old man. Kitano didn’t react. But two days later, the guy’s wife, a waitress in East Fishkill, New York, was bludgeoned almost beyond recognition. They had to use DNA to make the identification. The next day, the prisoner himself was found dead, bled out from a massive cut across the belly. Kitano’s alibi was unassailable: he was locked in his cell. There was no evidence connecting Kitano to any of it, but after that the other inmates avoided Hitoshi Kitano like the plague.

  Dunne focused on the screen. Kitano was watching the television with great concentration.

  “What’s he watching?”

  “Just a second.” He hit a few more keys, and the screen split, the right showing a feed from CNN, with a time stamp that matched the one from the camera showing Kitano.

  CNN was showing footage of Bellevue. The reports ran on, a talking head, pretty and blond, with a little curl to her lips. “Can you get audio?”

  “Sure.”

  Her voice came on, too loud until Robbins turned it down: “… is denying that this is connected to a case earlier in the day of a crazed young Japanese man found in Times Square, but an unnamed source who is an employee at the hospital challenges this assertion. The Japanese man, who sources identify as an undergraduate at Columbia University named Hitoshi Kitano, was missing his right middle finger.…”

  Kitano stiffened at the mention of his name. The other inmates looked toward him.

  “Hey, that’s you!” someone said. “Kitano! Your name’s on the TV!”

  Kitano stood, but he seemed shaky, holding on to the chair a moment, steadying himself. He watched the news piece to the end. Then he walked purposefully out of the room, the other prisoners parting before him.

  “And that’s that,” Robbins said, and clicked them back to the live view of Kitano’s cell. “He came back to his cell, turned on his radio to a news site, sat down, and hasn’t moved since.”

  Dunne kept thinking of a conversation with Kitano, almost ten years ago now. It was one of the most important conversations of Dunne’s life, before or since. The thirty-six-year-old foreign-policy wonk and the seventy-five-year-old billionaire were discussing the geopolitical consequences of biological weapons, drinking a very fine scotch, as was their custom. Both men believed that biological war was a near inevitability. The technology was moving so fast, sooner or later biological attacks could become commonplace between adversaries.

  It was unlikely that Europe would ever attack America with such weapons, nor would Japan. The Soviets had a huge biological-weapons program, but they had the good grace to collapse.

  The Chinese wouldn’t hesitate, both men agreed. Not if they felt threatened. Dunne believed the only way to avoid it was Pax Americana. To decapitate the Chinese Communist leadership and replace them with others woven into the U.S. tapestry.

  But how? How could one derail the China juggernaut before it became unstoppable?

  They’d danced around it for quite a while before Dunne finally said it: the Uzumaki.

  With the Uzumaki, they both agreed, it would be straightforward, once the United States had developed a cure.

  Although a decade had since passed, Dunne could remember the conversation word for word. “Where would you release it?” Kitano had asked.

  “One option is Harbin. Like construction stirred it up. Or near one of the Chinese agriculture ministry’s biological research facilities south of there. Make it look like the incompetent fools were working on the Uzumaki, accidentally released it themselves.”

  “Like the Soviet anthrax incident at Sverdlovsk in ’79?”

  “Exactly.”

  Together they’d sketched out how it would go from there. The Uzumaki spreads, the country is isolated. Every other nation, fearful of a pandemic, shuts off travel, closes down trade with China. The Communist Party’s hold on power was already te
nuous, propped up by the twin sticks of nationalist pride and the promise of economic growth. Robbed of that prosperity and angry at a leadership impotent before the spreading horror, the people would riot, first in the countryside, then in the cities. The State Council would collapse within weeks, the country plunging into chaos. The stage would be set for a joint United States–Japanese force to step in and restore order, backed by a cure and a bayonet.

  If the United States developed a cure, Kitano and Dunne speculated, it could bring down China anytime it wanted. The two men shared a secret bond, one that deepened as China continued to rise in power. The Uzumaki, the Japanese superweapon, might still change history. It was almost a game with them: two men planning the downfall of the most populous nation in the world.

  But then Kitano changed the game.

  The first report that something was amiss had come to Dunne from the CIA. A consortium of Central American and Asian agricultural investors had purchased ten thousand acres of Brazilian farmland about four hundred miles from where Toloff had discovered Fusarium spirale. On it they built a multimillion-dollar agricultural genetics research institute and agricultural experiment station called SunAgra. It was staffed with dozens of Ph.D.-level scientists with expertise ranging from crop science to fungal genetics, all living and working on-site. Their stated goal was to develop new strains of genetically modified maize for Far East markets. On the face of it, quite reasonable: corn had become a key crop throughout Asia. China was the number-two producer and consumer of corn in the world, and North Korea had become completely dependent on the crop under Kim Il-Sung. A little digging, however, turned up a number of alarming details. For one, scientists at the SunAgra Institute published no papers, wrote no grants, and filed few patents. Furthermore, one of the species they studied was a rare fungus known as Fusarium spirale, a strange choice, since it was unknown outside of a four-province area of Brazil and had no apparent relevance to the Far East markets. And most alarmingly, the investor group was largely a shell. More than ninety percent of the money behind the project came from a single Japanese investor, the billionaire Hitoshi Kitano.

  Kitano was running his own private Uzumaki program.

  DUNNE HAD NO CHOICE BUT TO TAKE ACTION. BUT HE WAS in a bind—Kitano could burn him. Much of the information Dunne had shared over the years during their China conversations was classified, putting him in violation of the State Secrets Protection Act. It was treason, sharing NOFORN classified information with a foreign national, not to mention plotting the overthrow of a foreign government. Such a thing could get you a very long prison term, possibly even a death sentence.

  Dunne had provided Kitano with classified information, and in turn Kitano had shared insider information about certain publicly traded Japanese companies. Kitano could reveal this to federal prosecutors, how Dunne, while sipping Kitano’s expensive scotch, had indiscreetly shared sensitive state secrets and subsequently made a small personal fortune in the Asian stock markets.

  Dunne had one thing in his favor. The U.S. government under no circumstances wanted to draw attention to the Uzumaki. The Japanese doomsday weapon was still unknown to all but a tightly held group in the security establishment. Toloff’s program at USDA was top secret, no foreigners. If word of it got out that the United States was tinkering around with a biological weapon of that magnitude, not to mention the connection to Unit 731 and the tests on Chinese civilians, Beijing would go ballistic.

  But Dunne also knew that no organization as large as Kitano’s could stay entirely on the correct side of the law. He ordered some digging done, and the next time Kitano arrived in the United States, federal marshals arrested him for tax evasion. The trial was quick and antiseptic. Kitano remained silent throughout the trial, and never took the stand in his own defense.

  Dunne had made sure of that. In a private meeting at Kitano’s estate before the trial, Dunne had threatened Kitano with the biggest weapon he had. “Tangle with me at your peril. We’ll disappear the Uzumaki program and then turn over everything on you to the Chinese Ministry of State Security: the records from Ishii, the photographs, the transcripts—anything and everything that implicates you in the torture and genocide of Chinese civilians. And after they’re good and worked up, we’ll turn you over to them for prosecution of war crimes.”

  That had shut Kitano up. Neither man spoke for almost a minute. Finally Kitano had said, “You have no fear that I will tell the Chinese everything?”

  “You don’t seem to realize that you lack any sort of credibility—a Japanese war criminal and mass murderer trying to save his skin? Listen closely. Beat the tax charges if you can, but close down SunAgra immediately. And stay far away from the Uzumaki.”

  ROBBINS PERKED UP. “LOOK. HE’S MOVING.”

  Kitano stood and went over to his small desk. He took down one of the books from his shelf, tore out a blank sheet from the back, then picked up a pen and set about writing.

  “Can you read that?” Dunne asked.

  “It’s too far away. Let me see if I can—”

  Kitano pulled his chair to the center of the cell, directly under the camera, and grabbed the page on which he had written. Then he stepped onto the chair and held up the paper so the image filled the screen.

  “Shit. He knows about the camera,” Robbins said.

  Dunne barely heard him. He was transfixed by the message.

  I CAN TELL YOU

  WHO SHE IS

  31

  VLAD GLAZMAN TYPED AS HARPO READ OFF THE SEQUENCE from the gel. The two had finished the second round of PCR and dielectrophoresis a half-hour ago, and were recording the genetic sequence of the glowing fungus. Harpo read off the bands, calling out a sequence of A’s, C’s, T’s, and G’s that Vlad dutifully transcribed.

  Harpo halted, took a great big sigh.

  “That’s it?” Vlad asked.

  “That’s it.”

  Vlad stared at the string of letters:

  GACTCGACTAGCTAGCAATTACTGATCAGCATT

  TTSCCCAATGCAGCATTTTCGACTGACCCGACT

  CGACTAGCTAGCAATTACTGATCAGCATTTTSC

  CCAATGCAGCATTTTCGAGCAAATCAGACTCG

  ACTAGCTAGCAATTACTGATCAGCATTTTSCCC

  AATGCAGCATTTTCGAGACTCGACTAGCTAGCA

  ATTACTGATCAGCATTTTSCCCAATGCAGCAT TTTCGA…

  It ran on for three pages.

  “Run it through the translator.”

  Vlad hit a sequence of keys, shipping the data to a simple script translator called BabelGene, which rendered it in alphanumeric form. Each three-letter codon corresponded to a letter of the alphabet, AAA for “a,” ACA for “b,” and so on. Connor had been the one that had originally proposed the standard.

  BabelGene did its job, and the screen filled with text.

  The Uzumaki is an extraordinarily dangerous weaponized version of the species known as Fusarium spirale. It is highly virulent, spreading by spores that can survive in human, avian, and agricultural hosts.…

  “Christ,” Harpo said.

  Vlad barely heard him, stunned as he read paragraph after paragraph detailing everything Connor had learned about the Uzumaki and everything he had done to try to defeat it. Not only that, but Connor said that he had one of the Uzumaki cylinders. Included in the message were the GPS coordinates of the location where it was hidden.

  “Shit,” Vlad said. “Double shit.”

  Vlad pushed Print. A LaserJet next to the computer fired up, spitting out a sheet of yellow paper with Connor’s revelations. Harpo grabbed the printout. “We should send this to someone.

  Now. CDC. FBI. CIA. Someone.”

  Vlad flipped his cellphone open. He hit Jake’s number. It rang once, then clicked off.

  He tried it again. Same result.

  He checked the bars. Plenty of signal. So what was wrong?

  Then he heard a pop, felt a splash of liquid on his cheek.

  Vlad turned.

  Harpo was falling, the back of his head gone.

  JAKE HEARD TWO SHOTS, THEN A QUICK BURST OF
FOUR more. He pulled at the cuffs, trying desperately to get loose. He was in the passenger’s seat of the FedEx van, held by a ring and chain welded to the floorboard. Maggie and Dylan were tied up in the back. A strap of flesh-colored tape covered his mouth.

  The cuffs holding him were virtually indestructible, brushed stainless steel with a rubberized lining and connected by a flexible band made from some kind of reinforced plastic. His bones would break before the cuffs would.

  He watched Harpo’s house, alert for any movement inside. Then another gunshot. Jake yanked with his arms, trying to pull loose the ring in the floor, but it was no use.

  Jake saw movement. Vlad shuffled around the corner of the house, dragging his right leg behind him. He looked to be badly hurt, hopping forward, holding a yellow printout in his hand. He looked desperate, focusing on his goal, each hop deepening his grimace.

  Jake tried to yell. Tried to warn him.

  He had no idea Orchid was right behind him.

  “VLADIMIR,” ORCHID SAID, AND WAITED FOR HIM TO TURN.

  She put the first bullet in his neck, just above the Adam’s apple. His mouth formed an O, but no sound came out. He went down straightaway, no fuss, gurgling and spitting up blood.

  She stood over him. The yellow printout was still in his grasp, jittering with the firing of his dying nerves.

  She knelt, put the silencer directly to his temple, and put in a second bullet to finish it.

  She waited until he was still, then pried the printout from his fingers.